PLA2G2E (NM_014589) Human Untagged Clone
CAT#: SC304136
PLA2G2E (untagged)-Human phospholipase A2, group IIE (PLA2G2E)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GIIE sPLA2; sPLA2-IIE |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC304136 representing NM_014589.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAATCTCCCCACGTGCTGGTGTTCCTTTGCCTCCTGGTGGCTCTGGTCACCGGGAACCTGGTTCAG TTTGGGGTGATGATCGAGAAGATGACAGGCAAGTCCGCCCTGCAGTACAACGACTATGGCTGTTACTGC GGCATCGGTGGCTCCCACTGGCCGGTGGACCAGACTGACTGGTGCTGCCACGCCCACGACTGCTGCTAC GGGCGTCTGGAGAAGCTGGGCTGTGAGCCCAAACTGGAAAAGTATCTTTTCTCTGTCAGCGAACGTGGC ATTTTCTGCGCCGGCAGGACCACCTGCCAGCGGCTGACCTGCGAGTGTGACAAGAGGGCTGCCCTCTGC TTTCGCCGCAACCTGGGCACCTACAACCGCAAATATGCCCATTATCCCAACAAGCTGTGCACCGGGCCC ACCCCGCCCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_014589 |
Insert Size | 429 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_014589.2 |
RefSeq Size | 487 bp |
RefSeq ORF | 429 bp |
Locus ID | 30814 |
UniProt ID | Q9NZK7 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway |
MW | 16 kDa |
Gene Summary | PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides. Has a preference for arachidonic-containing phospholipids.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213466 | PLA2G2E (Myc-DDK-tagged)-Human phospholipase A2, group IIE (PLA2G2E) |
CNY 1,200.00 |
|
RC213466L3 | Lenti ORF clone of Human phospholipase A2, group IIE (PLA2G2E), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213466L4 | Lenti ORF clone of Human phospholipase A2, group IIE (PLA2G2E), mGFP tagged |
CNY 5,890.00 |
|
RG213466 | PLA2G2E (tGFP-tagged) - Human phospholipase A2, group IIE (PLA2G2E) |
CNY 4,370.00 |
其它PLA2G2E产品