DPS1 (PDSS1) (NM_014317) Human Untagged Clone
CAT#: SC304078
PDSS1 (untagged)-Human prenyl (decaprenyl) diphosphate synthase, subunit 1 (PDSS1)
CN¥ 3,656.00
CN¥ 6,650.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | COQ1; COQ1A; COQ10D2; DPS; hDPS1; SPS; TPRT; TPT; TPT 1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_014317 edited
ATGGCCTCGCGCTGGTGGCGGTGGCGGCGCGGCTGCTCCTGGAAGCCGGCGGCGCGGAGC CCCGGGCCCGGCTCCCCCGGCCGTGCGGGACCGTTGGGGCCGAGCGCCGCTGCCGAAGTC CGCGCGCAGGTTCATAGGCGGAAGGGACTTGACTTGTCTCAGATACCCTATATTAATCTT GTGAAGCATTTAACATCTGCCTGTCCAAATGTATGTCGTATATCACGGTTTCATCACACA ACCCCAGACAGTAAAACACACAGTGGTGAAAAATACACCGATCCTTTCAAACTCGGTTGG AGAGACTTGAAAGGTCTGTATGAGGACATTAGAAAGGAACTGCTTATATCAACATCAGAA CTTAAGGAAATGTCTGAGTACTACTTTGATGGGAAAGGGAAAGCCTTTCGACCAATTATT GTGGCGCTAATGGCCCGAGCATGCAATATTCATCATAACAACTCCCGACATGTGCAAGCC AGCCAGCGCGCCATAGCCTTAATTGCAGAAATGATCCACACTGCTAGTCTGGTTCACGAT GACGTTATTGACGATGCAAGTTCTCGAAGAGGAAAACACACAGTTAATAAGATCTGGGGT GAAAAGAAGGCTGTTCTTGCTGGAGATTTAATTCTTTCTGCAGCATCTATAGCTCTGGCA CGAATTGGAAATACAACTGTTATATCTATTTTAACCCAAGTTATTGAAGATTTGGTGCGT GGTGAATTTCTTCAGCTCGGGTCAAAAGAAAATGAGAATGAAAGATTTGCACACTACCTT GAGAAGACATTCAAGAAGACCGCCAGCCTGATAGCCAACAGTTGTAAAGCAGTCTCTGTT CTAGGATGTCCCGACCCAGTGGTGCATGAGATCGCCTATCAGTACGGAAAAAATGTAGGA ATAGCTTTTCAGCTAATAGATGATGTATTGGACTTCACCTCGTGTTCTGACCAGATGGGC AAACCAACATCAGCTGATCTGAAGCTCGGGTTAGCCACTGGTCCTGTCCTGTTTGCCTGT CAGCAGTTCCCAGAAATGAATGCTATGATCATGCGACGGTTCAGTTTGCCTGGAGATGTA GACAGAGCTCGACAGTATGTACTACAGAGTGATGGTGTGCAACAAACAACCTACCTCGCC CAGCAGTACTGCCATGAAGCAATAAGAGAGATCAGTAAACTTCGACCATCCCCAGAAAGA GATGCCCTCATTCAGCTTTCAGAAATTGTACTCACAAGAGATAAATGA |
Restriction Sites | Please inquire |
ACCN | NM_014317 |
Insert Size | 1700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_014317.3, NP_055132.2 |
RefSeq Size | 1679 bp |
RefSeq ORF | 1248 bp |
Locus ID | 23590 |
UniProt ID | Q5T2R2 |
Protein Pathways | Terpenoid backbone biosynthesis |
Gene Summary | The protein encoded by this gene is an enzyme that elongates the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. The protein may be peripherally associated with the inner mitochondrial membrane, though no transit peptide has been definitively identified to date. Defects in this gene are a cause of coenzyme Q10 deficiency. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212263 | PDSS1 (Myc-DDK-tagged)-Human prenyl (decaprenyl) diphosphate synthase, subunit 1 (PDSS1) |
CN¥ 3,656.00 |
|
RC212263L1 | Lenti ORF clone of Human prenyl (decaprenyl) diphosphate synthase, subunit 1 (PDSS1), Myc-DDK-tagged |
CN¥ 6,056.00 |
|
RC212263L2 | Lenti ORF clone of Human prenyl (decaprenyl) diphosphate synthase, subunit 1 (PDSS1), mGFP tagged |
CN¥ 5,890.00 |
|
RC212263L3 | Lenti ORF clone of Human prenyl (decaprenyl) diphosphate synthase, subunit 1 (PDSS1), Myc-DDK-tagged |
CN¥ 5,890.00 |
|
RC212263L4 | Lenti ORF clone of Human prenyl (decaprenyl) diphosphate synthase, subunit 1 (PDSS1), mGFP tagged |
CN¥ 5,890.00 |
|
RG212263 | PDSS1 (tGFP-tagged) - Human prenyl (decaprenyl) diphosphate synthase, subunit 1 (PDSS1) |
CN¥ 4,370.00 |