United States
Germany
Japan
United Kingdom
China
Doppel (PRND) (NM_012409) Human Untagged Clone
CAT＃: SC303977
PRND (untagged)-Human prion protein 2 (dublet) (PRND)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | dJ1068H6.4; DOPPEL; DPL; PrPLP |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_012409 edited
ATGAGGAAGCACCTGAGCTGGTGGTGGCTGGCCACTGTCTGCATGCTGCTCTTCAGCCAC CTCTCTGCGGTCCAGACGAGGGGCATCAAGCACAGAATCAAGTGGAACCGGAAGGCCCTG CCCAGCACTGCCCAGATCACTGAGGCCCAGGTGGCTGAGAACCGCCCGGGAGCCTTCATC AAGCAAGGCCGCAAGCTCGACATTGACTTCGGAGCCGAGGGCAACAGGTACTACGAGGCC AACTACTGGCAGTTCCCCGATGGCATCCACTACAACGGCTGCTCTGAGGCTAATGTGACC AAGGAGGCATTTGTCACCGGCTGCATCAATGCCACCCAGGCGGCGAACCAGGGGGAGTTC CAGAAGCCAGACAACAAGCTCCACCAGCAGGTGCTCTGGCGGCTGGTCCAGGAGCTCTGC TCCCTCAAGCATTGCGAGTTTTGGTTGGAGAGGGGCGCAGGACTTCGGGTCACCATGCAC CAGCCAGTGCTCCTCTGCCTTCTGGCTTTGATCTGGCTCATGGTGAAATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_012409 |
| Insert Size | 2000 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_012409.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_012409.2, NP_036541.2 |
| RefSeq Size | 4047 bp |
| RefSeq ORF | 531 bp |
| Locus ID | 23627 |
| UniProt ID | Q9UKY0 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene is found on chromosome 20, approximately 20 kbp downstream of the gene encoding cellular prion protein, to which it is biochemically and structurally similar. The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that is found predominantly in testis. Mutations in this gene may lead to neurological disorders. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223341 | PRND (Myc-DDK-tagged)-Human prion protein 2 (dublet) (PRND) |
CNY 3,600.00 |
|
| RC223341L3 | Lenti ORF clone of Human prion protein 2 (dublet) (PRND), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC223341L4 | Lenti ORF clone of Human prion protein 2 (dublet) (PRND), mGFP tagged |
CNY 6,000.00 |
|
| RG223341 | PRND (tGFP-tagged) - Human prion protein 2 (dublet) (PRND) |
CNY 5,200.00 |
