TIM 1 (HAVCR1) (NM_012206) Human Untagged Clone
CAT#: SC303942
HAVCR1 (untagged)-Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1
CNY 7,220.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD365; HAVCR; HAVCR-1; KIM-1; KIM1; TIM; TIM-1; TIM1; TIMD-1; TIMD1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303942 representing NM_012206.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCATCCTCAAGTGGTCATCTTAAGCCTCATCCTACATCTGGCAGATTCTGTAGCTGGTTCTGTAAAG GTTGGTGGAGAGGCAGGTCCATCTGTCACACTACCCTGCCACTACAGTGGAGCTGTCACATCCATGTGC TGGAATAGAGGCTCATGTTCTCTATTCACATGCCAAAATGGCATTGTCTGGACCAATGGAACCCACGTC ACCTATCGGAAGGACACACGCTATAAGCTATTGGGGGACCTTTCAAGAAGGGATGTCTCTTTGACCATA GAAAATACAGCTGTGTCTGACAGTGGCGTATATTGTTGCCGTGTTGAGCACCGTGGGTGGTTCAATGAC ATGAAAATCACCGTATCATTGGAGATTGTGCCACCCAAGGTCACGACTACTCCAATTGTCACAACTGTT CCAACCGTCACGACTGTTCGAACGAGCACCACTGTTCCAACGACAACGACTGTTCCAATGACGACTGTT CCAACGACAACTGTTCCAACAACAATGAGCATTCCAACGACAACGACTGTTCTGACGACAATGACTGTT TCAACGACAACGAGCGTTCCAACGACAACGAGCATTCCAACAACAACAAGTGTTCCAGTGACAACAACT GTCTCTACCTTTGTTCCTCCAATGCCTTTGCCCAGGCAGAACCATGAACCAGTAGCCACTTCACCATCT TCACCTCAGCCAGCAGAAACCCACCCTACGACACTGCAGGGAGCAATAAGGAGAGAACCCACCAGCTCA CCATTGTACTCTTACACAACAGATGGGAATGACACCGTGACAGAGTCTTCAGATGGCCTTTGGAATAAC AATCAAACTCAACTGTTCCTAGAACATAGTCTACTGACGGCCAATACCACTAAAGGAATCTATGCTGGA GTCTGTATTTCTGTCTTGGTGCTTCTTGCTCTTTTGGGTGTCATCATTGCCAAAAAGTATTTCTTCAAA AAGGAGGTTCAACAACTAAGTGTTTCATTTAGCAGCCTTCAAATTAAAGCTTTGCAAAATGCAGTTGAA AAGGAAGTCCAAGCAGAAGACAATATCTACATTGAGAATAGTCTTTATGCCACGGACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_012206 |
Insert Size | 1095 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_012206.3 |
RefSeq Size | 1713 bp |
RefSeq ORF | 1095 bp |
Locus ID | 26762 |
UniProt ID | Q96D42 |
Protein Families | Druggable Genome, Transmembrane |
MW | 39.2 kDa |
Gene Summary | The protein encoded by this gene is a membrane receptor for both human hepatitis A virus (HHAV) and TIMD4. The encoded protein may be involved in the moderation of asthma and allergic diseases. The reference genome represents an allele that retains a MTTVP amino acid segment that confers protection against atopy in HHAV seropositive individuals. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4, 12 and 19. [provided by RefSeq, Apr 2015] Transcript Variant: This variant (1) encodes the shorter isoform (a). Both variants 1 and 3 encode isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217039 | HAVCR1 (Myc-DDK-tagged)-Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1 |
CNY 5,488.00 |
|
RC217039L1 | Lenti ORF clone of Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC217039L2 | Lenti ORF clone of Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RC217039L3 | Lenti ORF clone of Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC217039L4 | Lenti ORF clone of Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RG217039 | HAVCR1 (tGFP-tagged) - Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1 |
CNY 7,088.00 |
|
SC317584 | HAVCR1 (untagged)-Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1 |
CNY 5,488.00 |