AGRP (NM_007316) Human Untagged Clone
CAT#: SC303908
AGRP (untagged)-Human agouti related protein homolog (mouse) (AGRP), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | agouti related protein; AGRT; Agrt; ART; Art; ASIP2; MGC118963; orexigenic neuropeptide |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303908 representing NM_007316.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGACCGCAGCGGTGCTGAGCTGTGCCCTGCTGCTGGCACTGCCTGCCACGCGAGGAGCCCAGATG GGCTTGGCCCCCATGGAGGGCATCAGAAGGCCTGACCAGGCCCTGCTCCCAGAGCTCCCAGGCCTGGGC CTGCGGGCCCCACTGAAGAAGACAACTGCAGAACAGGCAGAAGAGGATCTGTTGCAGGAGGCTCAGGCC TTGGCAGAGGTACTAGACCTGCAGGACCGCGAGCCCCGCTCCTCACGTCGCTGCGTAAGGCTGCATGAG TCCTGCCTGGGACAGCAGGTGCCTTGCTGTGACCCATGTGCCACGTGCTACTGCCGCTTCTTCAATGCC TTCTGCTACTGCCGCAAGCTGGGTACTGCCATGAATCCCTGCAGCCGCACCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_007316 |
Insert Size | 399 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_007316.1 |
RefSeq Size | 486 bp |
RefSeq ORF | 399 bp |
Locus ID | 181 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Adipocytokine signaling pathway |
MW | 14.4 kDa |
Gene Summary | This gene encodes an antagonist of the melanocortin-3 and melanocortin-4 receptor. It appears to regulate hypothalamic control of feeding behavior via melanocortin receptor and/or intracellular calcium regulation, and thus plays a role in weight homeostasis. Mutations in this gene have been associated with late on-set obesity. [provided by RefSeq, Dec 2009] Transcript Variant: Transcript variant 2 lacks a 5' noncoding exon and is expressed in peripheral tissues. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221553 | AGRP (Myc-DDK-tagged)-Human agouti related protein homolog (mouse) (AGRP), transcript variant 2 |
CNY 1,200.00 |
|
RC221553L3 | Lenti ORF clone of Human agouti related protein homolog (mouse) (AGRP), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221553L4 | Lenti ORF clone of Human agouti related protein homolog (mouse) (AGRP), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG221553 | AGRP (tGFP-tagged) - Human agouti related protein homolog (mouse) (AGRP), transcript variant 2 |
CNY 4,370.00 |