United States
Germany
Japan
United Kingdom
China
SHOX (NM_006883) Human Untagged Clone
CAT＃: SC303841
SHOX (untagged)-Human short stature homeobox (SHOX), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GCFX; PHOG; SHOXY; SS |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_006883, the custom clone sequence may differ by one or more nucleotides
ATGGAAGAGCTCACGGCTTTTGTATCCAAGTCTTTTGACCAGAAAAGCAAGGACGGTAAC GGCGGAGGCGGAGGCGGCGGAGGTAAGAAGGATTCCATTACGTACCGGGAAGTTTTGGAG AGCGGACTGGCGCGCTCCCGGGAGCTGGGGACGTCGGATTCCAGCCTCCAGGACATCACG GAGGGCGGCGGCCACTGCCCGGTGCATTTGTTCAAGGACCACGTAGACAATGACAAGGAG AAACTGAAAGAATTCGGCACCGCGAGAGTGGCAGAAGGGATTTATGAATGCAAAGAGAAG CGCGAGGACGTGAAGTCGGAGGACGAGGACGGGCAGACCAAGCTGAAACAGAGGCGCAGC CGCACCAACTTCACGCTGGAGCAGCTGAACGAGCTCGAGCGACTCTTCGACGAGACCCAT TACCCCGACGCCTTCATGCGCGAGGAGCTCAGCCAGCGCCTGGGGCTCTCCGAGGCGCGC GTGCAGGTTTGGTTCCAGAACCGGAGAGCCAAGTGCCGCAAACAAGAGAATCAGATGCAT AAAGGCGTCATCTTGGGCACAGCCAACCACCTAGACGCCTGCCGAGTGGCACCCTACGTC AACATGGGAGCCTTACGGATGCCTTTCCAACAGATGGAGTTTTGCTCTTGTCGCCCGGGC TGGAGTATAATGGCATGA |
| Restriction Sites | Please inquire |
| ACCN | NM_006883 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_006883.1, NP_006874.1 |
| RefSeq Size | 1952 bp |
| RefSeq ORF | 678 bp |
| Locus ID | 6473 |
| UniProt ID | O15266 |
| Protein Families | Transcription Factors |
| Gene Summary | This gene belongs to the paired homeobox family and is located in the pseudoautosomal region 1 (PAR1) of X and Y chromosomes. Defects in this gene are associated with idiopathic growth retardation and in the short stature phenotype of Turner syndrome patients. This gene is highly conserved across species from mammals to fish to flies. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) contains an alternate 3' terminal exon compared to transcript variant 1, and encodes a shorter isoform (SHOXb) with a different C-terminus compared to isoform SHOXa. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212490 | SHOX (Myc-DDK-tagged)-Human short stature homeobox (SHOX), transcript variant 2 |
CNY 3,990.00 |
|
| RC212490L3 | Lenti-ORF clone of SHOX (Myc-DDK-tagged)-Human short stature homeobox (SHOX), transcript variant 2 |
CNY 5,890.00 |
|
| RC212490L4 | Lenti-ORF clone of SHOX (mGFP-tagged)-Human short stature homeobox (SHOX), transcript variant 2 |
CNY 5,890.00 |
|
| RG212490 | SHOX (tGFP-tagged) - Human short stature homeobox (SHOX), transcript variant 2 |
CNY 4,370.00 |
