United States
Germany
Japan
United Kingdom
China
IL24 (NM_006850) Human Untagged Clone
CAT＃: SC303831
IL24 (untagged)-Human interleukin 24 (IL24), transcript variant 1
CNY 3,990.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C49A; FISP; IL10B; MDA7; MOB5; ST16 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC303831 representing NM_006850.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAATTTTCAACAGAGGCTGCAAAGCCTGTGGACTTTAGCCAGACCCTTCTGCCCTCCTTTGCTGGCG ACAGCCTCTCAAATGCAGATGGTTGTGCTCCCTTGCCTGGGTTTTACCCTGCTTCTCTGGAGCCAGGTA TCAGGGGCCCAGGGCCAAGAATTCCACTTTGGGCCCTGCCAAGTGAAGGGGGTTGTTCCCCAGAAACTG TGGGAAGCCTTCTGGGCTGTGAAAGACACTATGCAAGCTCAGGATAACATCACGAGTGCCCGGCTGCTG CAGCAGGAGGTTCTGCAGAACGTCTCGGATGCTGAGAGCTGTTACCTTGTCCACACCCTGCTGGAGTTC TACTTGAAAACTGTTTTCAAAAACTACCACAATAGAACAGTTGAAGTCAGGACTCTGAAGTCATTCTCT ACTCTGGCCAACAACTTTGTTCTCATCGTGTCACAACTGCAACCCAGTCAAGAAAATGAGATGTTTTCC ATCAGAGACAGTGCACACAGGCGGTTTCTGCTATTCCGGAGAGCATTCAAACAGTTGGACGTAGAAGCA GCTCTGACCAAAGCCCTTGGGGAAGTGGACATTCTTCTGACCTGGATGCAGAAATTCTACAAGCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_006850 |
| Insert Size | 621 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006850.3 |
| RefSeq Size | 1976 bp |
| RefSeq ORF | 621 bp |
| Locus ID | 11009 |
| UniProt ID | Q13007 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
| MW | 23.8 kDa |
| Gene Summary | This gene encodes a member of the IL10 family of cytokines. It was identified as a gene induced during terminal differentiation in melanoma cells. The protein encoded by this gene can induce apoptosis selectively in various cancer cells. Overexpression of this gene leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes isoform 1. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Interleukin-31 and oncostatin-M mediate distinct signaling reactions and response patterns in lung epithelial cells
,Souvik Chattopadhyay, Erin Tracy, Ping Liang, Olivier Robledo, Stefan Rose-John, and Heinz Baumann,
J Biol Chem. 2007 Feb 2;282(5):3014-26.
[IL24]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216502 | IL24 (Myc-DDK-tagged)-Human interleukin 24 (IL24), transcript variant 1 |
CNY 2,400.00 |
|
| RC216502L1 | Lenti ORF clone of Human interleukin 24 (IL24), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC216502L2 | Lenti ORF clone of Human interleukin 24 (IL24), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC216502L3 | Lenti ORF clone of Human interleukin 24 (IL24), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC216502L4 | Lenti ORF clone of Human interleukin 24 (IL24), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
| RG216502 | IL24 (tGFP-tagged) - Human interleukin 24 (IL24), transcript variant 1 |
CNY 4,000.00 |
