United States
Germany
Japan
United Kingdom
China
CST8 (NM_005492) Human Untagged Clone
CAT＃: SC303654
CST8 (untagged)-Human cystatin 8 (cystatin-related epididymal specific) (CST8)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CRES; CTES5 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC303654 representing NM_005492.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCCAGGTGCCGGTGGCTCTCCCTGATCCTCCTCACCATTCCCCTGGCCCTGGTGGCCAGGAAAGAC CCAAAAAAGAATGAGACAGGGGTGCTGAGGAAATTAAAACCCGTCAATGCCTCAAATGCCAACGTGAAG CAGTGTCTGTGGTTTGCCATGCAAGAATACAACAAAGAGAGCGAGGACAAGTATGTCTTCCTGGTGGTC AAGACACTGCAAGCCCAGCTTCAGGTCACAAATCTTCTGGAATACCTTATTGATGTAGAAATTGCCCGC AGCGATTGCAGAAAGCCTTTAAGCACTAATGAAATCTGCGCCATTCAAGAAAACTCCAAGCTGAAAAGG AAATTAAGCTGCAGCTTTTTGGTAGGAGCACTTCCCTGGAATGGTGAATTCACTGTGATGGAGAAAAAG TGTGAAGATGCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_005492 |
| Insert Size | 429 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_005492.3 |
| RefSeq Size | 923 bp |
| RefSeq ORF | 429 bp |
| Locus ID | 10047 |
| UniProt ID | O60676 |
| Protein Families | Secreted Protein |
| MW | 16.3 kDa |
| Gene Summary | The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a protein similar to type 2 cystatins. The encoded protein exhibits highly tissue-specific expression in the reproductive tract, suggesting implicit roles in reproduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210130 | CST8 (Myc-DDK-tagged)-Human cystatin 8 (cystatin-related epididymal specific) (CST8) |
CNY 1,200.00 |
|
| RC210130L1 | Lenti ORF clone of Human cystatin 8 (cystatin-related epididymal specific) (CST8), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC210130L2 | Lenti ORF clone of Human cystatin 8 (cystatin-related epididymal specific) (CST8), mGFP tagged |
CNY 5,890.00 |
|
| RC210130L3 | Lenti ORF clone of Human cystatin 8 (cystatin-related epididymal specific) (CST8), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC210130L4 | Lenti ORF clone of Human cystatin 8 (cystatin-related epididymal specific) (CST8), mGFP tagged |
CNY 5,890.00 |
|
| RG210130 | CST8 (tGFP-tagged) - Human cystatin 8 (cystatin-related epididymal specific) (CST8) |
CNY 2,800.00 |
