CER1 (NM_005454) Human Untagged Clone

CAT#: SC303647

CER1 (untagged) - Human cerberus 1, DAN family BMP antagonist (CER1)



  "NM_005454" in other vectors (4)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CER1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DAND4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_005454 edited
CATGCATCTCCTCTTATTTCAGCTGCTGGTACTCCTGCCTCTAGGAAAGACCACACGGCA
CCAGGATGGCCGCCAGAATCAGAGTTCTCTTTCCCCCGTACTCCTGCCAAGGAATCAAAG
AGAGCTTCCCACAGGCAACCATGAGGAAGCTGAGGAGAAGCCAGATCTGTTTGTCGCAGT
GCCACACCTTGTAGGCACCAGCCCTGCAGGGGAAGGCCAGAGGCAGAGAGAGAAGATGCT
GTCCAGATTTGGCAGGTTCTGGAAGAAGCCTGAGAGAGAAATGCATCCATCCAGGGACTC
AGATAGTGAGCCCTTCCCACCTGGGACCCAGTCCCTCATCCAGCCGATAGATGGAATGAA
AATGGAGAAATCTCCTCTTCGGGAAGAAGCCAAGAAATTCTGGCACCACTTCATGTTCAG
AAAAACTCCGGCTTCTCAGGGGGTCATCTTGCCCATCAAAAGCCATGAAGTACATTGGGA
GACCTGCAGGACAGTGCCCTTCAGCCAGACTATAACCCACGAAGGCTGTGAGAAATTAGT
TGTTCAGAACAACCTTTGCTTTGGGAAATGCGGGTCTGTTCATTTTCCTGGAGCCGCGCA
GCACTCCCATACCTCCTGCTCTCACTGTTTGCCTGCCAAGTTCACCACGATGCACTTGCC
ACTGAACTGCACTGAACTTTCCTCCGTGATCAAGGTGGTGATGCTGGTGGAGGAGTGCCA
GTGCAAGGTGAAGACGGAGCATGAAGATGGACACATCCTACATGCTGGCTCCCAGGATTC
CTTTATCCCAGGAGTTTCAGCTTGA
Restriction Sites Please inquire     
ACCN NM_005454
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to contain two SNPs compared with NM_005454.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005454.2, NP_005445.1
RefSeq Size 1206 bp
RefSeq ORF 804 bp
Locus ID 9350
UniProt ID O95813
Protein Families Secreted Protein
Protein Pathways Wnt signaling pathway
Gene Summary This gene encodes a cytokine member of the cysteine knot superfamily, characterized by nine conserved cysteines and a cysteine knot region. The cerberus-related cytokines, together with Dan and DRM/Gremlin, represent a group of bone morphogenetic protein (BMP) antagonists that can bind directly to BMPs and inhibit their activity. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...