CER1 (NM_005454) Human Untagged Clone
CAT#: SC303647
CER1 (untagged) - Human cerberus 1, DAN family BMP antagonist (CER1)
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DAND4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_005454 edited
CATGCATCTCCTCTTATTTCAGCTGCTGGTACTCCTGCCTCTAGGAAAGACCACACGGCA CCAGGATGGCCGCCAGAATCAGAGTTCTCTTTCCCCCGTACTCCTGCCAAGGAATCAAAG AGAGCTTCCCACAGGCAACCATGAGGAAGCTGAGGAGAAGCCAGATCTGTTTGTCGCAGT GCCACACCTTGTAGGCACCAGCCCTGCAGGGGAAGGCCAGAGGCAGAGAGAGAAGATGCT GTCCAGATTTGGCAGGTTCTGGAAGAAGCCTGAGAGAGAAATGCATCCATCCAGGGACTC AGATAGTGAGCCCTTCCCACCTGGGACCCAGTCCCTCATCCAGCCGATAGATGGAATGAA AATGGAGAAATCTCCTCTTCGGGAAGAAGCCAAGAAATTCTGGCACCACTTCATGTTCAG AAAAACTCCGGCTTCTCAGGGGGTCATCTTGCCCATCAAAAGCCATGAAGTACATTGGGA GACCTGCAGGACAGTGCCCTTCAGCCAGACTATAACCCACGAAGGCTGTGAGAAATTAGT TGTTCAGAACAACCTTTGCTTTGGGAAATGCGGGTCTGTTCATTTTCCTGGAGCCGCGCA GCACTCCCATACCTCCTGCTCTCACTGTTTGCCTGCCAAGTTCACCACGATGCACTTGCC ACTGAACTGCACTGAACTTTCCTCCGTGATCAAGGTGGTGATGCTGGTGGAGGAGTGCCA GTGCAAGGTGAAGACGGAGCATGAAGATGGACACATCCTACATGCTGGCTCCCAGGATTC CTTTATCCCAGGAGTTTCAGCTTGA |
Restriction Sites | Please inquire |
ACCN | NM_005454 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain two SNPs compared with NM_005454.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005454.2, NP_005445.1 |
RefSeq Size | 1206 bp |
RefSeq ORF | 804 bp |
Locus ID | 9350 |
UniProt ID | O95813 |
Protein Families | Secreted Protein |
Protein Pathways | Wnt signaling pathway |
Gene Summary | This gene encodes a cytokine member of the cysteine knot superfamily, characterized by nine conserved cysteines and a cysteine knot region. The cerberus-related cytokines, together with Dan and DRM/Gremlin, represent a group of bone morphogenetic protein (BMP) antagonists that can bind directly to BMPs and inhibit their activity. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210111 | CER1 (Myc-DDK-tagged) - Human cerberus 1, DAN family BMP antagonist (CER1) |
CNY 2,400.00 |
|
RC210111L3 | Lenti ORF clone of Human cerberus 1, DAN family BMP antagonist (CER1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210111L4 | Lenti ORF clone of Human cerberus 1, DAN family BMP antagonist (CER1), mGFP tagged |
CNY 5,890.00 |
|
RG210111 | CER1 (tGFP-tagged) - Human cerberus 1, DAN family BMP antagonist (CER1), mGFP tagged |
CNY 4,370.00 |