Histone H1.3 (HIST1H1D) (NM_005320) Human Untagged Clone

CAT#: SC303615

HIST1H1D (untagged)-Human histone cluster 1, H1d (HIST1H1D)



  "NM_005320" in other vectors (6)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


H1-3 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms H1.3; H1D; H1F3; H1s-2; HIST1H1D
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_005320, the custom clone sequence may differ by one or more nucleotides


ATGTCGGAGACTGCTCCACTTGCTCCTACCATTCCTGCACCCGCAGAAAAAACACCTGTGAAGAAAAAGG
CGAAGAAGGCAGGCGCAACTGCTGGGAAACGCAAAGCATCCGGACCCCCAGTATCTGAGCTTATCACCAA
GGCAGTGGCAGCTTCTAAGGAGCGCAGCGGCGTTTCTCTGGCCGCGCTTAAGAAAGCGCTTGCGGCTGCT
GGCTACGATGTAGAAAAAAACAACAGCCGTATCAAGCTTGGCCTCAAGAGCTTGGTGAGCAAAGGTACTC
TGGTGCAGACCAAAGGTACCGGTGCTTCTGGCTCCTTCAAACTCAACAAGAAAGCGGCTTCCGGGGAAGG
CAAACCCAAGGCCAAAAAGGCTGGCGCAGCCAAGCCTAGGAAGCCTGCTGGGGCAGCCAAGAAGCCCAAG
AAGGTGGCTGGCGCCGCTACCCCGAAGAAAAGCATCAAAAAGACTCCTAAGAAGGTAAAGAAGCCAGCAA
CCGCTGCTGGGACCAAGAAAGTGGCCAAGAGTGCGAAAAAGGTGAAAACACCTCAGCCAAAAAAAGCTGC
CAAGAGTCCAGCTAAGGCCAAAGCCCCTAAGCCCAAGGCGGCCAAGCCTAAGTCGGGGAAGCCGAAGGTT
ACAAAGGCAAAGAAGGCAGCTCCGAAGAAAAAGTGA


Restriction Sites Please inquire     
ACCN NM_005320
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005320.2, NP_005311.1
RefSeq Size 777 bp
RefSeq ORF 666 bp
Locus ID 3007
UniProt ID P16402
Gene Summary Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Aug 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...