United States
Germany
Japan
United Kingdom
China
CTLA4 (NM_005214) Human Untagged Clone
CAT＃: SC303605
CTLA4 (untagged)-Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 1
CNY 3,600.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ALPS5; CD; CD152; CELIAC3; CTLA-4; GRD4; GSE; IDDM12 |
| Vector | pCMV6-XL6 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_005214, the custom clone sequence may differ by one or more nucleotides
ATGGCTTGCCTTGGATTTCAGCGGCACAAGGCTCAGCTGAACCTGGCTACCAGGACCTGGCCCTGCACTC TCCTGTTTTTTCTTCTCTTCATCCCTGTCTTCTGCAAAGCAATGCACGTGGCCCAGCCTGCTGTGGTACT GGCCAGCAGCCGAGGCATCGCCAGCTTTGTGTGTGAGTATGCATCTCCAGGCAAAGCCACTGAGGTCCGG GTGACAGTGCTTCGGCAGGCTGACAGCCAGGTGACTGAAGTCTGTGCGGCAACCTACATGATGGGGAATG AGTTGACCTTCCTAGATGATTCCATCTGCACGGGCACCTCCAGTGGAAATCAAGTGAACCTCACTATCCA AGGACTGAGGGCCATGGACACGGGACTCTACATCTGCAAGGTGGAGCTCATGTACCCACCGCCATACTAC CTGGGCATAGGCAACGGAACCCAGATTTATGTAATTGATCCAGAACCGTGCCCAGATTCTGACTTCCTCC TCTGGATCCTTGCAGCAGTTAGTTCGGGGTTGTTTTTTTATAGCTTTCTCCTCACAGCTGTTTCTTTGAG CAAAATGCTAAAGAAAAGAAGCCCTCTTACAACAGGGGTCTATGTGAAAATGCCCCCAACAGAGCCAGAA TGTGAAAAGCAATTTCAGCCTTATTTTATTCCCATCAATTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_005214 |
| Insert Size | 750 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005214.3. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005214.3, NP_005205.2 |
| RefSeq Size | 1988 bp |
| RefSeq ORF | 672 bp |
| Locus ID | 1493 |
| UniProt ID | P16410 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Autoimmune thyroid disease, Cell adhesion molecules (CAMs), T cell receptor signaling pathway |
| Gene Summary | This gene is a member of the immunoglobulin superfamily and encodes a protein which transmits an inhibitory signal to T cells. The protein contains a V domain, a transmembrane domain, and a cytoplasmic tail. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The membrane-bound isoform functions as a homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. Mutations in this gene have been associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer membrane-bound isoform CTLA4-TM. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Leukemic B Cell CTLA-4 Suppresses Costimulation of T Cells
,Do, P;Beckwith, KA;Cheney, C;Tran, M;Beaver, L;Griffin, BG;Mo, X;Liu, Y;Lapalombella, R;Hertlein, E;Muthusamy, N;Byrd, JC;,
J. Immunol.
,PubMed ID 30910862
[CTLA4]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210150 | CTLA4 (Myc-DDK-tagged)-Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 1 |
CNY 2,400.00 |
|
| RC210150L1 | Lenti-ORF clone of CTLA4 (Myc-DDK-tagged)-Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 1 |
CNY 4,800.00 |
|
| RC210150L2 | Lenti-ORF clone of CTLA4 (mGFP-tagged)-Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 1 |
CNY 4,800.00 |
|
| RC210150L3 | Lenti-ORF clone of CTLA4 (Myc-DDK-tagged)-Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 1 |
CNY 4,800.00 |
|
| RC210150L4 | Lenti-ORF clone of CTLA4 (mGFP-tagged)-Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 1 |
CNY 4,800.00 |
|
| RG210150 | CTLA4 (tGFP-tagged) - Human cytotoxic T-lymphocyte-associated protein 4 (CTLA4), transcript variant 1 |
CNY 4,000.00 |
