SULT2B1 (NM_004605) Human Untagged Clone

CAT#: SC303504

SULT2B1 (untagged)-Human sulfotransferase family, cytosolic, 2B, member 1 (SULT2B1), transcript variant 1



  "NM_004605" in other vectors (4)

CNY 3,656.00

CNY 5,700.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SULT2B1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARCI14; HSST2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303504 representing NM_004605.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGTCTCCCCCACCTTTCCACAGCCAGAAGTTGCCAGGTGAATACTTCCGGTACAAGGGCGTCCCC
TTCCCCGTCGGCCTGTACTCGCTCGAGAGCATCAGCTTGGCGGAGAACACCCAAGATGTGCGGGACGAC
GACATCTTTATCATCACCTACCCCAAGTCAGGCACGACCTGGATGATCGAGATCATCTGCTTAATCCTG
AAGGAAGGGGATCCATCCTGGATCCGCTCCGTGCCCATCTGGGAGCGGGCACCCTGGTGTGAGACCATT
GTGGGTGCCTTCAGCCTCCCGGACCAGTACAGCCCCCGCCTCATGAGCTCCCATCTTCCCATCCAGATC
TTCACCAAGGCCTTCTTCAGCTCCAAGGCCAAGGTGATCTACATGGGCCGCAACCCCCGGGACGTTGTG
GTCTCCCTCTATCATTACTCCAAGATCGCCGGGCAGTTAAAGGACCCGGGCACACCCGACCAGTTCCTG
AGGGACTTCCTCAAAGGCGAAGTGCAGTTTGGCTCCTGGTTCGACCACATTAAGGGCTGGCTTCGGATG
AAGGGCAAAGACAACTTCCTATTTATCACCTACGAGGAGCTGCAGCAGGACTTACAGGGCTCCGTGGAG
CGCATCTGTGGGTTCCTGGGCCGTCCGCTGGGCAAGGAGGCACTGGGCTCCGTCGTGGCACACTCAACC
TTCAGCGCCATGAAGGCCAACACCATGTCCAACTACACGCTGCTGCCTCCCAGCCTGCTGGACCACCGT
CGCGGGGCCTTCCTCCGGAAAGGGGTCTGCGGCGACTGGAAGAACCACTTCACGGTGGCCCAGAGCGAA
GCCTTCGATCGTGCCTACCGCAAGCAGATGCGGGGGATGCCGACCTTCCCCTGGGATGAAGACCCGGAG
GAGGACGGCAGCCCAGATCCTGAGCCCAGCCCTGAGCCTGAGCCCAAGCCCAGCCTTGAGCCCAACACC
AGCCTGGAGCGTGAGCCCAGACCCAACTCCAGCCCCAGCCCCAGCCCCGGCCAGGCCTCTGAGACCCCG
CACCCACGACCCTCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_004605
Insert Size 1053 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004605.2
RefSeq Size 1281 bp
RefSeq ORF 1053 bp
Locus ID 6820
UniProt ID O00204
Domains Sulfotransfer
Protein Pathways Androgen and estrogen metabolism, Sulfur metabolism
MW 39.6 kDa
Gene Summary Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene sulfates dehydroepiandrosterone but not 4-nitrophenol, a typical substrate for the phenol and estrogen sulfotransferase subfamilies. Two alternatively spliced variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1), also known as SULT2B1a, differs in the 5' UTR and in the coding region when compared to variant 2. The resulting protein (isoform a) has a shorter and distinct N-terminus compared to isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...