United States
Germany
Japan
United Kingdom
China
CRABP1 (NM_004378) Human Untagged Clone
CAT＃: SC303475
CRABP1 (untagged)-Human cellular retinoic acid binding protein 1 (CRABP1)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CRABP; CRABP-I; CRABPI; RBP5 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC303475 representing NM_004378.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCCAACTTCGCCGGCACCTGGAAGATGCGCAGCAGCGAGAATTTCGACGAGCTGCTCAAGGCACTG GGTGTGAACGCCATGCTGAGGAAAGTGGCCGTAGCGGCTGCGTCCAAGCCGCACGTGGAGATCCGCCAG GACGGGGATCAGTTCTACATCAAGACATCCACCACGGTGCGCACCACTGAGATCAACTTCAAGGTCGGA GAAGGCTTTGAGGAGGAGACCGTGGACGGACGCAAGTGCAGGAGTTTAGCCACTTGGGAGAATGAGAAC AAGATCCACTGCACGCAAACTCTTCTTGAAGGGGACGGCCCCAAAACCTACTGGACCCGTGAGCTGGCC AACGATGAACTTATCCTGACGTTTGGCGCCGATGACGTGGTCTGCACCAGAATTTATGTCCGAGAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_004378 |
| Insert Size | 414 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_004378.2 |
| RefSeq Size | 782 bp |
| RefSeq ORF | 414 bp |
| Locus ID | 1381 |
| UniProt ID | P29762 |
| MW | 15.6 kDa |
| Gene Summary | This gene encodes a specific binding protein for a vitamin A family member and is thought to play an important role in retinoic acid-mediated differentiation and proliferation processes. It is structurally similar to the cellular retinol-binding proteins, but binds only retinoic acid at specific sites within the nucleus, which may contribute to vitamin A-directed differentiation in epithelial tissue. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223810 | CRABP1 (Myc-DDK-tagged)-Human cellular retinoic acid binding protein 1 (CRABP1) |
CNY 1,200.00 |
|
| RC223810L1 | Lenti ORF clone of Human cellular retinoic acid binding protein 1 (CRABP1), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC223810L2 | Lenti ORF clone of Human cellular retinoic acid binding protein 1 (CRABP1), mGFP tagged |
CNY 5,890.00 |
|
| RC223810L3 | Lenti ORF clone of Human cellular retinoic acid binding protein 1 (CRABP1), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC223810L4 | Lenti ORF clone of Human cellular retinoic acid binding protein 1 (CRABP1), mGFP tagged |
CNY 5,890.00 |
|
| RG223810 | CRABP1 (tGFP-tagged) - Human cellular retinoic acid binding protein 1 (CRABP1) |
CNY 2,800.00 |
