Urocortin (UCN) (NM_003353) Human Untagged Clone

CAT#: SC303296

UCN (untagged)-Human urocortin (UCN)



  "NM_003353" in other vectors (4)

CNY 1,320.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-UCN Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UI; UROC
Vector pCMV6-Entry
E. coli Selection None
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_003353, the custom clone sequence may differ by one or more nucleotides
ATGAGGCAGGCGGGACGCGCAGCGCTGCTGGCCGCGCTGCTGCTCCTGGTACAGCTGTGC
CCTGGGAGCAGCCAGAGGAGCCCCGAGGCGGCCGGGGTCCAGGACCCGAGTCTGCGCTGG
AGCCCCGGGGCACGGAACCAGGGTGGCGGGGCCCGCGCGCTCCTCTTGCTGCTGGCGGAG
CGCTTCCCGCGCCGCGCGGGGCCCGGCCGATTGGGACTCGGGACGGCAGGCGAGCGGCCG
CGGCGGGACAACCCTTCTCTGTCCATTGACCTCACCTTTCACCTGCTGCGGACCCTGCTG
GAGCTGGCGCGGACGCAGAGCCAGCGGGAGCGCGCCGAGCAGAACCGCATCATATTCGAC
TCGGTGGGCAAGTGA
Restriction Sites Please inquire     
ACCN NM_003353
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003353.2, NP_003344.1
RefSeq Size 615 bp
RefSeq ORF 375 bp
Locus ID 7349
UniProt ID P55089
Protein Families Druggable Genome, Secreted Protein
Gene Summary This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family. The encoded preproprotein is proteolytically processed to generate the mature peptide, an endogenous ligand for both corticotropin-releasing factor receptor 1 and corticotropin-releasing factor receptor 2. In the brain this peptide may be responsible for the effects of stress on appetite. This peptide may also play a role in mood disorders, neurodegeneration, and skeletal system disorders. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin-2. [provided by RefSeq, Feb 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...