Urocortin (UCN) (NM_003353) Human Untagged Clone
CNY 1,320.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | UI; UROC |
Vector | pCMV6-Entry |
E. coli Selection | None |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_003353, the custom clone sequence may differ by one or more nucleotides
ATGAGGCAGGCGGGACGCGCAGCGCTGCTGGCCGCGCTGCTGCTCCTGGTACAGCTGTGC CCTGGGAGCAGCCAGAGGAGCCCCGAGGCGGCCGGGGTCCAGGACCCGAGTCTGCGCTGG AGCCCCGGGGCACGGAACCAGGGTGGCGGGGCCCGCGCGCTCCTCTTGCTGCTGGCGGAG CGCTTCCCGCGCCGCGCGGGGCCCGGCCGATTGGGACTCGGGACGGCAGGCGAGCGGCCG CGGCGGGACAACCCTTCTCTGTCCATTGACCTCACCTTTCACCTGCTGCGGACCCTGCTG GAGCTGGCGCGGACGCAGAGCCAGCGGGAGCGCGCCGAGCAGAACCGCATCATATTCGAC TCGGTGGGCAAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_003353 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_003353.2, NP_003344.1 |
RefSeq Size | 615 bp |
RefSeq ORF | 375 bp |
Locus ID | 7349 |
UniProt ID | P55089 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family. The encoded preproprotein is proteolytically processed to generate the mature peptide, an endogenous ligand for both corticotropin-releasing factor receptor 1 and corticotropin-releasing factor receptor 2. In the brain this peptide may be responsible for the effects of stress on appetite. This peptide may also play a role in mood disorders, neurodegeneration, and skeletal system disorders. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin-2. [provided by RefSeq, Feb 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222576 | UCN (Myc-DDK-tagged)-Human urocortin (UCN) |
CNY 3,990.00 |
|
RC222576L3 | Lenti-ORF clone of UCN (Myc-DDK-tagged)-Human urocortin (UCN) |
CNY 5,890.00 |
|
RC222576L4 | Lenti-ORF clone of UCN (mGFP-tagged)-Human urocortin (UCN) |
CNY 5,890.00 |
|
RG222576 | UCN (tGFP-tagged) - Human urocortin (UCN) |
CNY 4,370.00 |
其它Urocortin产品