TSPY1 (NM_003308) Human Untagged Clone

CAT#: SC303293

TSPY1 (untagged)-Human testis specific protein, Y-linked 1 (TSPY1), transcript variant 1



  "NM_003308" in other vectors (4)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-TSPY1/TSPY3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT78; DYS14; pJA923; TSPY
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_003308 edited
AACAGGCCCTTCGCGCGCAGTCCCTTAGGGGGCGCCTGGAAGCCCGGCGCATGCGCCCTG
AGGGCTCGCTGACCTACCGGGTGCCAGAGAGGCTGCGGCAGGGTTTCTGTGGCGTGGGTC
GGGCAGCACAGGCCTTGGTGTGTGCGAGTGCCAAGGAGGGCACCGCCTTCAGGATGGAGG
CTGTACAGGAGGGGGCGGCCGGGGTGGAGAGTGAGCAGGCGGCTTTGGGGGAGGAGGCGG
TGCTGCTGTTGGATGACATAATGGCGGAGGTGGAGGTGGTGGCGGAGGAGGAGGGCCTCG
TGGAGCGGCGGGAGGAGGCCCAGCGGGCACAGCAGGCTGTGCCTGGCCCTGGGCCCATGA
CCCCAGAGTCTGCACTGGAGGAGCTGCTGGCCGTTCAGGTGGAGCTGGAGCCGGTTAATG
CCCAAGCCAGGAAGGCCTTTTCTCGGCAGCGGGAAAAGATGGAGCGGAGGCGCAAGCCCC
ACCTAGACCGCAGAGGCGCCGTCATCCAGAGCGTCCCTGGCTTCTGGGCCAATGTTATTG
CAAACCACCCCCAGATGTCAGCCCTGATCACTGACGAAGATGAAGACATGCTGAGCTACA
TGGTCAGCCTGGAGGTGGRAGAAGAGAAGCATCCTGTTCATCTCTGCAAGATCATGTTGT
TCTTTCGGAGTAACCCCTACTTCCAGAATAAAGTGATTACCAAGGAATATCTGGTGAACA
TCACAGAATACAGGGCTTCTCATTCCACTCCAATTGAGTGGTATCCGGATTATGAAGTGG
AGGCCTATCGCCGCAGACACCACAACAGCAGCCTTAACTTCTTCAACTGGTTCTCTGACC
ACAACTTCGCAGGATCTAACAAGATTGCTGAGATCCTATGTAAGGACCTGTGGCGCAATC
CCCTGCAATACTACAAGAGGATGAAGCCACCTGAAGAGGGAACAGAGACRTCAGGGGACT
CCCAGTTGTTGAGTTGAATATGATGGAGCATCAGATTTTACCTAATACAGCAGAACTCCT
AAAAAGTTACAGCCATATGCAGGA
Restriction Sites Please inquire     
ACCN NM_003308
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003308.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_003308.2, NP_003299.1
RefSeq Size 1159 bp
RefSeq ORF 927 bp
Locus ID 7258
UniProt ID Q01534
Gene Summary The protein encoded by this gene is found only in testicular tissue and may be involved in spermatogenesis. Many functional paralogs and pseudogenes of this gene are present in a cluster in humans, but only a single, nonfunctional orthologous gene is found in mouse. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (1) encodes the longer isoform (TSPY-S). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...