SHOX2 (NM_003030) Human Untagged Clone

CAT#: SC303264

SHOX2 (untagged)-Human short stature homeobox 2 (SHOX2), transcript variant 1



  "NM_003030" in other vectors (5)

CNY 7,220.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SHOX2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms OG12; OG12X; SHOT
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_003030, the custom clone sequence may differ by one or more nucleotides
ATGGAAGAACTTACGGCGTTCGTCTCCAAGTCTTTTGACCAGAAAGTGAAGGAGAAGAAG
GAGGCGATCACGTACCGGGAGGTGCTGGAGAGCGGGCCGCTGCGCGGGGCCAAGGAGCCG
ACCGGCTGCACCGAGGCGGGCCGCGACGACCGCAGCAGCCCGGCAGTCCGGGCGGCCGGC
GGAGGCGGCGGCGGAGGAGGCGGAGGCGGCGGCGGAGGAGGCGGAGGAGGTGTAGGAGGA
GGAGGAGCAGGCGGAGGAGCTGGAGGAGGGCGCTCTCCCGTCCGGGAGCTGGACATGGGC
GCCGCCGAGAGAAGCAGGGAGCCGGGCAGCCCGCGACTGACGGAGGGTAGAAGGAAGCCA
ACGAAAGCTGAGGTCCAGGCTACGCTGCTTCTCCCGGGCGAGGCGTTTCGGTTTCTTGTG
TCCCCGGAGCTGAAAGATCGCAAAGAGGATGCGAAAGGGATGGAGGACGAAGGCCAGACC
AAAATCAAGCAGAGGCGAAGTCGGACCAATTTCACCCTGGAACAACTCAATGAGCTGGAG
AGGCTTTTTGACGAGACCCACTATCCCGACGCCTTCATGCGAGAGGAACTGAGCCAGCGA
CTGGGCCTGTCGGAGGCCCGAGTGCAGGTTTGGTTTCAAAATCGAAGAGCTAAATGTAGA
AAACAAGAAAATCAACTCCATAAAGGTGTTCTCATAGGGGCCGCCAGCCAGTTTGAAGCT
TGTAGAGTCGCACCTTATGTCAACGTAGGTGCTTTAAGGATGCCATTTCAGCAGGATAGT
CATTGCAACGTGACGCCCTTGTCCTTTCAGGTTCAGGCGCAGCTGCAGCTGGACAGCGCT
GTGGCGCACGCGCACCACCACCTGCATCCGCACCTGGCCGCGCACGCGCCCTACATGATG
TTCCCAGCACCGCCCTTCGGACTGCCGCTCGCCACGCTGGCCGCGGATTCGGCTTCCGCC
GCCTCGGTAGTGGCGGCCGCAGCAGCCGCCAAGACCACCAGCAAGAACTCCAGCATCGCC
GATCTCAGACTGAAAGCCAAAAAGCACGCCGCAGCCCTGGGTCTGTGA
Restriction Sites Please inquire     
ACCN NM_003030
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003030.2, NP_003021.1
RefSeq Size 1696 bp
RefSeq ORF 573 bp
Locus ID 6474
UniProt ID O60902
Protein Families Transcription Factors
Gene Summary This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...