Neurotrophin 3 (NTF3) (NM_002527) Human Untagged Clone

CAT#: SC303212

NTF3 (untagged)-Human neurotrophin 3 (NTF3), transcript variant 2



  "NM_002527" in other vectors (6)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-NT3 (Neurotrophin 3) mouse monoclonal antibody, clone OTI5C7 (formerly 5C7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HDNF; NGF-2; NGF2; NT-3; NT3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002527 edited
TGCCAGAATAACACAGACTCAGCTGCCAGAGCCTGCTCTTAACACCTGTGTTTCCTTTTC
AGATCTTACAGGTGAACAAGGTGATGTCCATCTTGTTTTATGTGATATTTCTCGCTTATC
TCCGTGGCATCCAAGGTAACAACATGGATCAAAGGAGTTTGCCAGAAGACTCGCTCAATT
CCCTCATTATTAAGCTGATCCAGGCAGATATTTTGAAAAACAAGCTCTCCAAGCAGATGG
TGGACGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGCTGAGGCTCCCCGAGAGCCGG
AGCGGGGAGGGCCCGCCAAGTCAGCATTCCAGCCGGTGATTGCAATGGACACCGAACTGC
TGCGACAACAGAGACGCTACAACTCACCGCGGGTCCTGCTGAGCGACAGCACCCCCTTGG
AGCCCCCGCCCTTGTATCTCATGGAGGATTACGTGGGCAGCCCCGTGGTGGCGAACAGAA
CATCACGGCGGAAACGGTACGCGGAGCATAAGAGTCACCGAGGGGAGTACTCGGTATGTG
ACAGTGAGAGTCTGTGGGTGACCGACAAGTCATCGGCCATCGACATTCGGGGACACCAGG
TCACGGTGCTGGGGGAGATCAAAACGGGCAACTCTCCCGTCAAACAATATTTTTATGAAA
CGCGATGTAAGGAAGCCAGGCCGGTCAAAAACGGTTGCAGGGGTATTGATGATAAACACT
GGAACTCTCAGTGCAAAACATCCCAAACCTACGTCCGAGCACTGACTTCAGAGAACAATA
AACTCGTGGGCTGGCGGTGGATACGGATAGACACGTCCTGTGTGTGTGCCTTGTCGAGAA
AAATCGGAAGAACATGAATTGGCATCTCTCCCCATATATAAATTATTACTTTAAATTATA
TGATATGCATGTAGCATATAAATGTTTATATTGTTTTTATATATTATAAGTTGACCTTTA
TTTATTAAACTTCAGCAACCCTACAGTATATAAGCTTTTTTCTCAATAAAATCAGTGTGC
TTGCCTTC
Restriction Sites Please inquire     
ACCN NM_002527
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002527.3.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002527.3, NP_002518.1
RefSeq Size 1204 bp
RefSeq ORF 774 bp
Locus ID 4908
UniProt ID P20783
Protein Families Druggable Genome, Secreted Protein
Protein Pathways MAPK signaling pathway, Neurotrophin signaling pathway
Gene Summary The protein encoded by this gene is a member of the neurotrophin family, that controls survival and differentiation of mammalian neurons. This protein is closely related to both nerve growth factor and brain-derived neurotrophic factor. It may be involved in the maintenance of the adult nervous system, and may affect development of neurons in the embryo when it is expressed in human placenta. NTF3-deficient mice generated by gene targeting display severe movement defects of the limbs. The mature peptide of this protein is identical in all mammals examined including human, pig, rat and mouse. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has an alternate 5' sequence and uses a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...