MSI1 (NM_002442) Human Untagged Clone
CAT#: SC303202
MSI1 (untagged)-Human musashi homolog 1 (Drosophila) (MSI1)
CNY 5,488.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_002442 edited
CGCCGCCCGCGGCTCCCGATGGAGACTGACGCGCCCCAGCCCGGCCTCGCCTCCCCGGAC TCGCCGCACGACCCCTGCAAGATGTTCATCGGGGGACTCAGTTGGCAGACTACGCAGGAA GGGCTGCGCGAATACTTCGGCCAGTTCGGGGAGGTGAAGGAGTGTCTGGTGATGCGGGAC CCCCTGACCAAGAGATCCAGGGGTTTCGGCTTCGTCACTTTCATGGACCAGGCGGGGGTG GATAAAGTGCTGGCGCAATCGCGGCACGAGCTCGACTCCAAAACAATTGACCCTAAGGTG GCCTTCCCTCGGCGAGCACAGCCCAAGATGGTGACTCGAACGAAGAAGATCTTTGTGGGG GGGCTGTCGGTGAACACCACGGTGGAGGACGTGAAGCAATATTTTGAGCAGTTTGGGAAG GTGGACGACGCCATGCTGATGTTTGACAAAACCACCAACCGGCACCGAGGGTTCGGGTTT GTCACGTTTGAGAGTGAGGACATCGTGGAGAAAGTGTGTGAAATTCATTTTCATGAAATC AACAACAAAATGGTGGAATGTAAGAAAGCTCAGCCAAAGGAGGTGATGTCGCCAACGGGC TCAGCCCGGGGGAGGTCTCGAGTCATGCCCTACGGAATGGACGCCTTCATGCTGGGCATC GGCATGCTGGGTTACCCAGGTTTCCAAGCCACAACCTACGCCAGCCGGAGTTATACAGGC CTCGCCCCTGGCTACACCTACCAGTTCCCCGAATTCCGTGTAGAGCGGACCCCTCTCCCG AGCGCCCCAGTCCTCCCCGAGCTTACAGCCATTCCTCTCACTGCCTACGGACCAATGGCG GCGGCAGCGGCGGCAGCGGCTGTGGTTCGAGGGACAGGCTCTCACCCCTGGACGATGGCT CCCCCTCCAGGTTCGACTCCCAGCCGCACAGGGGGCTTCCTGGGGACCACCAGCCCCGGC CCCATGGCCGAGCTCTACGGGGCGGCCAACCAGGACTCGGGGGTCAGCAGTTACATCAGC GCCGCCAGCCCTGCCCCCAGCACCGGCTTCGGCCACAGTCTTGGGGGCCCTTTGATTGCC ACAGCCTTCACCAATGGGTACCACTGAAG |
Restriction Sites | Please inquire |
ACCN | NM_002442 |
Insert Size | 1100 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002442.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002442.2, NP_002433.1 |
RefSeq Size | 2950 bp |
RefSeq ORF | 1089 bp |
Locus ID | 4440 |
UniProt ID | O43347 |
Gene Summary | This gene encodes a protein containing two conserved tandem RNA recognition motifs. Similar proteins in other species function as RNA-binding proteins and play central roles in posttranscriptional gene regulation. Expression of this gene has been correlated with the grade of the malignancy and proliferative activity in gliomas and melanomas. A pseudogene for this gene is located on chromosome 11q13. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215992 | MSI1 (Myc-DDK-tagged)-Human musashi homolog 1 (Drosophila) (MSI1) |
CNY 5,488.00 |
|
RC215992L1 | Lenti ORF clone of Human musashi homolog 1 (Drosophila) (MSI1), Myc-DDK-tagged |
CNY 7,888.00 |
|
RC215992L2 | Lenti ORF clone of Human musashi homolog 1 (Drosophila) (MSI1), mGFP tagged |
CNY 5,890.00 |
|
RC215992L3 | Lenti ORF clone of Human musashi homolog 1 (Drosophila) (MSI1), Myc-DDK-tagged |
CNY 7,888.00 |
|
RC215992L4 | Lenti ORF clone of Human musashi homolog 1 (Drosophila) (MSI1), mGFP tagged |
CNY 7,888.00 |
|
RG215992 | MSI1 (tGFP-tagged) - Human musashi homolog 1 (Drosophila) (MSI1) |
CNY 7,088.00 |