MAGEB1 (NM_002363) Human Untagged Clone
CAT#: SC303186
MAGEB1 (untagged)-Human melanoma antigen family B, 1 (MAGEB1), transcript variant 1
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT3.1; DAM10; MAGE-Xp; MAGEL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303186 representing NM_002363.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCTCGGGGTCAGAAGAGTAAGCTCCGTGCTCGTGAGAAACGCCGCAAGGCGCGAGAGGAGACCCAG GGTCTCAAGGTTGCTCACGCCACTGCAGCAGAGAAAGAGGAGTGCCCCTCCTCCTCTCCTGTTTTAGGG GATACTCCCACAAGCTCCCCTGCTGCTGGCATTCCCCAGAAGCCTCAGGGAGCTCCACCCACCACCACT GCTGCTGCAGCTGTGTCATGTACCGAATCTGACGAAGGTGCCAAATGCCAAGGTGAGGAAAATGCAAGT TTCTCCCAGGCCACAACATCCACTGAGAGCTCAGTCAAAGATCCTGTAGCCTGGGAGGCAGGAATGCTG ATGCACTTCATTCTACGTAAGTATAAAATGAGAGAGCCCATTATGAAGGCAGATATGCTGAAGGTTGTT GATGAAAAGTACAAGGATCACTTCACTGAGATCCTCAATGGAGCCTCTCGCCGCTTGGAGCTCGTCTTT GGCCTTGATTTGAAGGAAGACAACCCTAGTGGCCACACCTACACCCTCGTCAGTAAGCTAAACCTCACC AATGATGGAAACCTGAGCAATGATTGGGACTTTCCCAGGAATGGGCTTCTGATGCCTCTCCTGGGTGTG ATCTTCTTAAAGGGCAACTCTGCCACCGAGGAAGAGATCTGGAAATTCATGAATGTGTTGGGAGCCTAT GATGGAGAGGAGCACTTAATCTATGGGGAACCCCGTAAGTTCATCACCCAAGATCTGGTGCAGGAAAAA TATCTGAAGTACGAGCAGGTGCCCAACAGTGATCCCCCACGCTATCAATTCCTATGGGGTCCGAGAGCC TATGCTGAAACCACCAAGATGAAAGTCCTCGAGTTTTTGGCCAAGATGAATGGTGCCACTCCCCGTGAC TTCCCATCCCATTATGAAGAGGCTTTGAGAGATGAGGAAGAGAGAGCCCAAGTCCGATCCAGTGTTAGA GCCAGGCGTCGCACTACTGCCACGACTTTTAGAGCGCGTTCTAGAGCCCCATTCAGCAGGTCCTCCCAC CCCATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_002363 |
Insert Size | 1044 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002363.4 |
RefSeq Size | 1865 bp |
RefSeq ORF | 1044 bp |
Locus ID | 4112 |
UniProt ID | P43366 |
MW | 39 kDa |
Gene Summary | This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. This gene is localized in the DSS (dosage-sensitive sex reversal) critical region, and expressed in testis and in a significant fraction of tumors of various histological types. This gene and other MAGEB members are clustered on chromosome Xp22-p21. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene, however, the full length nature of some variants has not been defined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) is the longest transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215656 | MAGEB1 (Myc-DDK-tagged)-Human melanoma antigen family B, 1 (MAGEB1), transcript variant 1 |
CNY 5,488.00 |
|
RC215656L1 | Lenti ORF clone of Human melanoma antigen family B, 1 (MAGEB1), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC215656L2 | Lenti ORF clone of Human melanoma antigen family B, 1 (MAGEB1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC215656L3 | Lenti ORF clone of Human melanoma antigen family B, 1 (MAGEB1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215656L4 | Lenti ORF clone of Human melanoma antigen family B, 1 (MAGEB1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG215656 | MAGEB1 (tGFP-tagged) - Human melanoma antigen family B, 1 (MAGEB1), transcript variant 1 |
CNY 7,088.00 |