United States
Germany
Japan
United Kingdom
China
IFNW1 (NM_002177) Human Untagged Clone
CAT＃: SC303138
IFNW1 (untagged)-Human interferon, omega 1 (IFNW1)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_002177 edited
TCCCAGCTCAGTAAAGCCAGGAGCATCCTCATTTCCCAATGGCCCTCCTGTTCCCTCTAC TGGCAGCCCTAGTGATGACCAGCTATAGCCCTGTTGGATCTCTGGGCTGTGATCTGCCTC AGAACCATGGCCTACTTAGCAGGAACACCTTGGTGCTTCTGCACCAAATGAGGAGAATCT CCCCTTTCTTGTGTCTCAAGGACAGAAGAGACTTCAGGTTCCCCCAGGAGATGGTAAAAG GGAGCCAGTTGCAGAAGGCCCATGTCATGTCTGTCCTCCATGAGATGCTGCAGCAGATCT TCAGCCTCTTCCACACAGAGCGCTCCTCTGCTGCCTGGAACATGACCCTCCTAGACCAAC TCCACACTGGACTTCATCAGCAACTGCAACACCTGGAGACCTGCTTGCTGCAGGTAGTGG GAGAAGGAGAATCTGCTGGGGCAATTAGCAGCCCTGCACTGACCTTGAGGAGGTACTTCC AGGGAATCCGTGTCTACCTGAAAGAGAAGAAATACAGCGACTGTGCCTGGGAAGTTGTCA GAATGGAAATCATGAAATCCTTGTTCTTATCAACAAACATGCAAGAAAGACTGAGAAGTA AAGATAGAGACCTGGGCTCATCTTGAAATGATTCTCATTGATTAATTTGCCATATAACAC TTGCACATGTGACTCTGGTCAATTCAAAAGACTCTTATTTCGGCTTTAATCACAGAATTG ACTGAATTAGTTCTGCAAATACTTTGTCGGTATATTAAGCCAGTATATGTTAAAAAGACT TAGGTTCAGGGGCATCAGTCC |
| Restriction Sites | Please inquire |
| ACCN | NM_002177 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002177.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002177.1, NP_002168.1 |
| RefSeq Size | 1514 bp |
| RefSeq ORF | 588 bp |
| Locus ID | 3467 |
| UniProt ID | P05000 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, RIG-I-like receptor signaling pathway |
| Gene Summary | The protein encoded by this gene is an interferon and possesses antiviral activity. The encoded protein binds to the interferon alpha/beta receptor but not to the interferon gamma receptor. This intronless gene has several pseudogenes spread throughout the genome. [provided by RefSeq, Nov 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222484 | IFNW1 (Myc-DDK-tagged)-Human interferon, omega 1 (IFNW1) |
CNY 2,400.00 |
|
| RC222484L1 | Lenti ORF clone of Human interferon, omega 1 (IFNW1), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC222484L2 | Lenti ORF clone of Human interferon, omega 1 (IFNW1), mGFP tagged |
CNY 5,890.00 |
|
| RC222484L3 | Lenti ORF clone of Human interferon, omega 1 (IFNW1), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC222484L4 | Lenti ORF clone of Human interferon, omega 1 (IFNW1), mGFP tagged |
CNY 5,890.00 |
|
| RG222484 | IFNW1 (tGFP-tagged) - Human interferon, omega 1 (IFNW1) |
CNY 4,000.00 |
