United States
Germany
Japan
United Kingdom
China
CD1C (NM_001765) Human Untagged Clone
CAT＃: SC303067
CD1C (untagged)-Human CD1c molecule (CD1C)
CNY 3,656.00
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BDCA1; CD1; CD1A; R7 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001765 edited
TTTCTGAGAGAAAGAAACATCTGCAAATGACATGCTGTTTCTGCAGTTTCTGCTGCTAGC TCTTCTTCTCCCAGGTGGTGACAATGCAGACGCATCCCAGGAACACGTCTCCTTCCATGT CATCCAGATCTTCTCATTTGTCAACCAATCCTGGGCACGAGGTCAGGGCTCAGGATGGCT GGACGAGTTGCAGACTCATGGCTGGGACAGTGAATCAGGCACAATAATTTTCCTGCATAA CTGGTCCAAGGGCAACTTCAGCAATGAAGAGTTGTCAGACCTAGAGTTGTTATTTCGTTT CTACCTCTTTGGATTAACTCGGGAGATTCAAGACCATGCAAGTCAAGATTACTCGAAATA TCCCTTTGAAGTACAGGTGAAAGCGGGCTGTGAGCTGCATTCTGGAAAGAGCCCAGAAGG CTTCTTTCAGGTAGCTTTCAACGGATTAGATTTACTGAGTTTCCAGAATACAACATGGGT GCCATCTCCAGGCTGTGGAAGTTTGGCCCAAAGTGTCTGTCATCTACTCAATCATCAGTA TGAAGGCGTCACAGAAACAGTGTATAATCTCATAAGAAGCACTTGCCCCCGATTTCTCTT GGGTCTCCTGGATGCAGGGAAGATGTATGTACACAGGCAAGTGAGGCCAGAAGCCTGGCT GTCCAGTCGCCCCAGCCTTGGGTCTGGCCAGCTGTTGCTGGTTTGTCATGCCTCCGGCTT CTACCCAAAGCCTGTTTGGGTGACATGGATGCGGAATGAACAGGAGCAACTGGGCACTAA ACATGGTGATATTCTTCCTAATGCTGATGGGACATGGTATCTTCAGGTGATCCTGGAGGT GGCATCTGAGGAGCCTGCTGGCCTGTCTTGTCGAGTGAGACACAGCAGTCTAGGAGGCCA GGACATCATCCTCTACTGGGGACACCACTTTTCCATGAATTGGATTGCCTTGGTAGTGAT AGTGCCCTTGGTGATTCTAATAGTCCTTGTGTTATGGTTTAAGAAGCACTGCTCATATCA GGACATCCTGTGAGACTCTTCCCCCTGACTCCCC |
| Restriction Sites | Please inquire |
| ACCN | NM_001765 |
| Insert Size | 1050 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001765.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001765.1, NP_001756.1 |
| RefSeq Size | 1207 bp |
| RefSeq ORF | 1002 bp |
| Locus ID | 911 |
| UniProt ID | P29017 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Hematopoietic cell lineage |
| Gene Summary | This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene is broadly distributed throughout the endocytic system via a tyrosine-based motif in the cytoplasmic tail. Alternatively spliced transcript variants of this gene have been observed, but their full-length nature is not known. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218490 | CD1C (Myc-DDK-tagged)-Human CD1c molecule (CD1C) |
CNY 2,400.00 |
|
| RC218490L1 | Lenti ORF clone of Human CD1c molecule (CD1C), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC218490L2 | Lenti ORF clone of Human CD1c molecule (CD1C), mGFP tagged |
CNY 5,890.00 |
|
| RC218490L3 | Lenti ORF clone of Human CD1c molecule (CD1C), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC218490L4 | Lenti ORF clone of Human CD1c molecule (CD1C), mGFP tagged |
CNY 4,800.00 |
|
| RG218490 | CD1C (tGFP-tagged) - Human CD1c molecule (CD1C) |
CNY 4,370.00 |
