CD1C (NM_001765) Human Untagged Clone

CAT#: SC303067

CD1C (untagged)-Human CD1c molecule (CD1C)



  "NM_001765" in other vectors (6)

CN¥ 3,656.00

CN¥ 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
CD1C mouse monoclonal antibody, clone OTI2F4 (formerly 2F4)
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BDCA1; CD1; CD1A; R7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001765 edited
TTTCTGAGAGAAAGAAACATCTGCAAATGACATGCTGTTTCTGCAGTTTCTGCTGCTAGC
TCTTCTTCTCCCAGGTGGTGACAATGCAGACGCATCCCAGGAACACGTCTCCTTCCATGT
CATCCAGATCTTCTCATTTGTCAACCAATCCTGGGCACGAGGTCAGGGCTCAGGATGGCT
GGACGAGTTGCAGACTCATGGCTGGGACAGTGAATCAGGCACAATAATTTTCCTGCATAA
CTGGTCCAAGGGCAACTTCAGCAATGAAGAGTTGTCAGACCTAGAGTTGTTATTTCGTTT
CTACCTCTTTGGATTAACTCGGGAGATTCAAGACCATGCAAGTCAAGATTACTCGAAATA
TCCCTTTGAAGTACAGGTGAAAGCGGGCTGTGAGCTGCATTCTGGAAAGAGCCCAGAAGG
CTTCTTTCAGGTAGCTTTCAACGGATTAGATTTACTGAGTTTCCAGAATACAACATGGGT
GCCATCTCCAGGCTGTGGAAGTTTGGCCCAAAGTGTCTGTCATCTACTCAATCATCAGTA
TGAAGGCGTCACAGAAACAGTGTATAATCTCATAAGAAGCACTTGCCCCCGATTTCTCTT
GGGTCTCCTGGATGCAGGGAAGATGTATGTACACAGGCAAGTGAGGCCAGAAGCCTGGCT
GTCCAGTCGCCCCAGCCTTGGGTCTGGCCAGCTGTTGCTGGTTTGTCATGCCTCCGGCTT
CTACCCAAAGCCTGTTTGGGTGACATGGATGCGGAATGAACAGGAGCAACTGGGCACTAA
ACATGGTGATATTCTTCCTAATGCTGATGGGACATGGTATCTTCAGGTGATCCTGGAGGT
GGCATCTGAGGAGCCTGCTGGCCTGTCTTGTCGAGTGAGACACAGCAGTCTAGGAGGCCA
GGACATCATCCTCTACTGGGGACACCACTTTTCCATGAATTGGATTGCCTTGGTAGTGAT
AGTGCCCTTGGTGATTCTAATAGTCCTTGTGTTATGGTTTAAGAAGCACTGCTCATATCA
GGACATCCTGTGAGACTCTTCCCCCTGACTCCCC
Restriction Sites Please inquire     
ACCN NM_001765
Insert Size 1050 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001765.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001765.1, NP_001756.1
RefSeq Size 1207 bp
RefSeq ORF 1002 bp
Locus ID 911
UniProt ID P29017
Protein Families Druggable Genome, Transmembrane
Protein Pathways Hematopoietic cell lineage
Gene Summary This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene is broadly distributed throughout the endocytic system via a tyrosine-based motif in the cytoplasmic tail. Alternatively spliced transcript variants of this gene have been observed, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...