CA5A (NM_001739) Human Untagged Clone

CAT#: SC303062

CA5A (untagged)-Human carbonic anhydrase VA, mitochondrial (CA5A), nuclear gene encoding mitochondrial protein



  "NM_001739" in other vectors (4)

CN¥ 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-CA5A antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CA5; CA5AD; CAV; CAVA; GS1-21A4.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303062 representing NM_001739.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTGGGGAGGAACACTTGGAAGACCTCAGCTTTCTCCTTCTTGGTTGAGCAGATGTGGGCCCCTCTC
TGGAGTCGTTCGATGAGGCCAGGGCGATGGTGTTCTCAGCGTTCCTGTGCATGGCAAACCAGCAATAAC
ACTTTGCACCCACTCTGGACGGTCCCGGTCTCCGTGCCAGGGGGCACCCGGCAGTCTCCTATTAACATC
CAGTGGAGGGACAGCGTCTATGACCCCCAGCTGAAGCCACTCAGGGTCTCCTATGAAGCGGCATCCTGC
CTGTACATCTGGAACACTGGCTACCTCTTCCAGGTGGAATTTGACGATGCCACCGAGGCATCAGGAATT
AGTGGTGGGCCCTTGGAAAACCACTACAGACTGAAGCAATTTCACTTCCACTGGGGAGCAGTGAACGAG
GGGGGCTCAGAGCACACAGTGGACGGCCACGCGTACCCCGCAGAGCTGCATTTAGTTCACTGGAATTCT
GTGAAATACCAAAATTACAAGGAAGCTGTCGTGGGAGAGAATGGTTTGGCTGTGATAGGCGTGTTTTTA
AAGCTCGGGGCCCATCATCAGACGCTGCAGAGGCTGGTGGACATCTTGCCGGAAATAAAACATAAGGAC
GCGCGGGCGGCCATGCGCCCCTTCGACCCCTCCACTCTGCTGCCCACCTGCTGGGATTACTGGACCTAC
GCGGGCTCGCTCACCACCCCGCCGCTGACCGAGTCGGTCACCTGGATCATCCAGAAGGAGCCCGTTGAA
GTGGCCCCAAGCCAGCTCTCTGCATTTCGTACTCTCCTGTTTTCTGCACTTGGTGAAGAGGAGAAGATG
ATGGTGAACAACTATCGCCCACTTCAACCCTTGATGAACCGGAAGGTCTGGGCGTCCTTCCAGGCCACT
AATGAGGGCACAAGGTCCTAG

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001739
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001739.1
RefSeq Size 1084 bp
RefSeq ORF 918 bp
Locus ID 763
UniProt ID P35218
Protein Families Druggable Genome
Protein Pathways Nitrogen metabolism
MW 34.8 kDa
Gene Summary Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA VA is localized in the mitochondria and expressed primarily in the liver. It may play an important role in ureagenesis and gluconeogenesis. CA5A gene maps to chromosome 16q24.3 and an unprocessed pseudogene has been assigned to 16p12-p11.2. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...