Flt3 ligand (FLT3LG) (NM_001459) Human Untagged Clone
CAT#: SC303027
FLT3LG (untagged)-Human fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 3
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 3,990.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FL; FLG3L; FLT3L |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001459 edited
CCCCTTCCACACCCAACTGGGGCAAGCCTGACCCGGCGACAGGAGGCATGAGGGGCCCCC GGCCGAAATGACAGTGCTGGCGCCAGCCTGGAGCCCAACGACCTATCTCCTCCTGCTGCT GCTGCTGAGCTCGGGACTCAGTGGGACCCAGGACTGCTCCTTCCAACACAGCCCCATCTC CTCCGACTTCGCTGTCAAAATCCGTGAGCTGTCTGACTACCTGCTTCAAGATTACCCAGT CACCGTGGCCTCCAACCTGCAGGACGAGGAGCTCTGCGGGGGCCTCTGGCGGCTGGTCCT GGCACAGCGCTGGATGGAGCGGCTCAAGACTGTCGCTGGGTCCAAGATGCAAGGCTTGCT GGAGCGCGTGAACACGGAGATACACTTTGTCACCAAATGTGCCTTTCAGCCCCCCCCCAG CTGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACCTCCGAGCAGCT GGTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCCGGTGCCTGGAGCTGCAGTG TCAGCCCGACTCCTCAACCCTGCCACCCCCATGGAGTCCCCGGCCCCTGGAGGCCACAGC CCCGACAGCCCCGCAGCCCCCTCTGCTCCTCCTACTGCTGCTGCCCGTGGGCCTCCTGCT GCTGGCCGCTGCCTGGTGCCTGCACTGGCAGAGGACGCGGCGGAGGACACCCCGCCCTGG GGAGCAGGTGCCCCCCGTCCCCAGTCCCCAGGACCTGCTGCTTGTGGAGCACTGACCTGG CCAAGGCCTCATCCTGGGGAGGATACTGAGGCACACAGAGGGGAGTCACCAGCCAGAGGA TGCATAGCCTGGACACAGAGGAAGTTGGCTAGAGGCCGGTCCCTTCCTTGGGCCCCTCTC ATTCCCTCCCCAGAATGGAGGCAACGCCAGAAT |
Restriction Sites | Please inquire |
ACCN | NM_001459 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001459.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001459.2, NP_001450.2 |
RefSeq Size | 1056 bp |
RefSeq ORF | 708 bp |
Locus ID | 2323 |
UniProt ID | P49771 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Pathways in cancer |
Gene Summary | Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3LG controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 (see MIM 186910)-positive classical DCs and their CD103 (ITGAE; MIM 604682)-positive tissue counterparts (summary by Sathaliyawala et al., 2010 [PubMed 20933441]).[supplied by OMIM, Jan 2011] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222242 | FLT3LG (Myc-DDK-tagged)-Human fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 3 |
CNY 2,400.00 |
|
RC222242L1 | Lenti ORF clone of Human fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC222242L2 | Lenti ORF clone of Human fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RC222242L3 | Lenti ORF clone of Human fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC222242L4 | Lenti ORF clone of Human fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 3, mGFP tagged |
CNY 4,800.00 |
|
RG222242 | FLT3LG (tGFP-tagged) - Human fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 3 |
CNY 4,000.00 |
其它Flt3 ligand产品