United States
Germany
Japan
United Kingdom
China
CDC42SE2 (NM_001038702) Human Untagged Clone
CAT＃: SC302954
CDC42SE2 (untagged)-Human CDC42 small effector 2 (CDC42SE2), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SPEC2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302954 representing NM_001038702.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTGAATTCTGGTTGTGTTTCAACTGCTGTATTGCAGAACAGCCTCAGCCTAAAAGGCGACGGCGG ATTGACAGAAGTATGATTGGAGAGCCCACAAACTTTGTGCATACAGCTCATGTTGGATCAGGAGACCTG TTCAGTGGAATGAATTCAGTTAGCTCCATTCAGAACCAAATGCAGTCCAAGGGAGGTTATGGAGGTGGA ATGCCTGCCAATGTCCAGATGCAGCTCGTGGATACGAAGGCGGGATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001038702 |
| Insert Size | 255 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001038702.1 |
| RefSeq Size | 3498 bp |
| RefSeq ORF | 255 bp |
| Locus ID | 56990 |
| UniProt ID | Q9NRR3 |
| Protein Families | Druggable Genome |
| MW | 9.2 kDa |
| Gene Summary | Probably involved in the organization of the actin cytoskeleton by acting downstream of CDC42, inducing actin filament assembly. Alters CDC42-induced cell shape changes. In activated T-cells, may play a role in CDC42-mediated F-actin accumulation at the immunological synapse. May play a role in early contractile events in phagocytosis in macrophages.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an exon in the 5'UTR compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212152 | CDC42SE2 (Myc-DDK-tagged)-Human CDC42 small effector 2 (CDC42SE2), transcript variant 2 |
CNY 1,200.00 |
|
| RC212152L3 | Lenti ORF clone of Human CDC42 small effector 2 (CDC42SE2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC212152L4 | Lenti ORF clone of Human CDC42 small effector 2 (CDC42SE2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG212152 | CDC42SE2 (tGFP-tagged) - Human CDC42 small effector 2 (CDC42SE2), transcript variant 2 |
CNY 4,370.00 |
其它CDC42SE2产品
