DEFB116 (NM_001037731) Human Untagged Clone
CAT#: SC302930
DEFB116 (untagged)-Human defensin, beta 116 (DEFB116)
CNY 1,200.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DEFB-16 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001037731 edited
CAGAAGGGCCGTCAAGGCCCACCATGTCAGTCATGAAGCCCTGTTTAATGACCATTGCCA TCCTTATGATCCTGGCTCAAAAGACTCCAGGTGGCCTGTTCAGATCCCACAATGGCAAGA GCCGAGAGCCTTGGAATCCATGTGAGCTTTACCAAGGCATGTGCAGAAACGCCTGCAGAG AATATGAAATCCAATACTTAACCTGCCCAAATGATCAAAAGTGCTGCCTGAAACTTTCTG TGAAAATAACCAGTTCTAAAAATGTGAAGGAGGATTACGACTCTAACTCCAACTTGTCAG TTACAAACAGTTCAAGCTACTCTCACATTTAAGGCCTCATGGGC |
Restriction Sites | Please inquire |
ACCN | NM_001037731 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001037731.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001037731.1, NP_001032820.1 |
RefSeq Size | 309 bp |
RefSeq ORF | 309 bp |
Locus ID | 245930 |
UniProt ID | Q30KQ4 |
Protein Families | Secreted Protein |
Gene Summary | Defensins form a family of antimicrobial and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. [provided by RefSeq, Oct 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218553 | DEFB116 (Myc-DDK-tagged)-Human defensin, beta 116 (DEFB116) |
CNY 1,200.00 |
|
RC218553L3 | Lenti ORF clone of Human defensin, beta 116 (DEFB116), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218553L4 | Lenti ORF clone of Human defensin, beta 116 (DEFB116), mGFP tagged |
CNY 5,890.00 |
|
RG218553 | DEFB116 (tGFP-tagged) - Human defensin, beta 116 (DEFB116) |
CNY 4,370.00 |
其它DEFB116产品