EEF1B2 (NM_001037663) Human Untagged Clone
CAT#: SC302922
EEF1B2 (untagged)-Human eukaryotic translation elongation factor 1 beta 2 (EEF1B2), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EEF1B; EEF1B1; EF1B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302922 representing NM_001037663.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGTTTCGGAGACCTGAAAAGCCCTGCCGGCCTCCAGGTGCTCAACGATTACCTGGCGGACAAGAGC TACATCGAGGGGTATGTGCCATCACAAGCAGATGTGGCAGTATTTGAAGCCGTGTCCAGCCCACCGCCT GCCGACTTGTGTCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTG CCAGGAGTGAAGAAAGCTTTGGGCAAATATGGTCCTGCCGATGTGGAAGACACTACAGGAAGTGGAGCT ACAGATAGTAAAGATGATGATGACATTGACCTCTTTGGATCTGATGATGAGGAGGAAAGTGAAGAAGCA AAGAGGCTAAGGGAAGAACGTCTTGCACAATATGAATCAAAGAAAGCCAAAAAACCTGCACTTGTTGCC AAGTCTTCCATCTTACTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCGAAATTAGAGGAGTGC GTCAGAAGCATTCAAGCAGACGGCTTAGTCTGGGGCTCATCTAAACTAGTTCCAGTGGGATACGGAATT AAGAAACTTCAAATACAGTGTGTAGTTGAAGATGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATC ACTGCTTTTGAGGACTATGTGCAGTCCATGGATGTGGCTGCTTTCAACAAGATCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037663 |
Insert Size | 678 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001037663.1 |
RefSeq Size | 900 bp |
RefSeq ORF | 678 bp |
Locus ID | 1933 |
UniProt ID | P24534 |
MW | 24.8 kDa |
Gene Summary | This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5' UTR. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) has a distinct 5' UTR compared to variants 1 and 2. Variants 1, 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209768 | EEF1B2 (Myc-DDK-tagged)-Human eukaryotic translation elongation factor 1 beta 2 (EEF1B2), transcript variant 3 |
CNY 2,400.00 |
|
RC209768L3 | Lenti ORF clone of Human eukaryotic translation elongation factor 1 beta 2 (EEF1B2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC209768L4 | Lenti ORF clone of Human eukaryotic translation elongation factor 1 beta 2 (EEF1B2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG209768 | EEF1B2 (tGFP-tagged) - Human eukaryotic translation elongation factor 1 beta 2 (EEF1B2), transcript variant 3 |
CNY 4,000.00 |