GGPS1 (NM_001037278) Human Untagged Clone
CAT#: SC302872
GGPS1 (untagged)-Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GGPPS; GGPPS1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302872 representing NM_001037278.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTGCATAATGCCAGTTTACTCATCGATGATATTGAAGACAACTCAAAACTCCGACGTGGCTTTCCA GTGGCCCACAGCATCTATGGAATCCCATCTGTCATCAATTCTGCCAATTACGTGTATTTCCTTGGCTTG GAGAAAGTCTTAACCCTTGATCACCCAGATGCAGTGAAGCTTTTTACCCGCCAGCTTTTGGAACTCCAT CAGGGACAAGGCCTAGATATTTACTGGAGGGATAATTACACTTGTCCCACTGAAGAAGAATATAAAGCT ATGGTGCTGCAGAAAACAGGTGGACTGTTTGGATTAGCAGTAGGTCTCATGCAGTTGTTCTCTGATTAC AAAGAAGATTTAAAACCGCTACTTAATACACTTGGGCTCTTTTTCCAAATTAGGGATGATTATGCTAAT CTACACTCCAAAGAATATAGTGAAAACAAAAGTTTTTGTGAAGATCTGACAGAGGGAAAGTTCTCATTT CCTACTATTCATGCTATTTGGTCAAGGCCTGAAAGCACCCAGGTGCAGAATATCTTGCGCCAGAGAACA GAAAACATAGATATAAAAAAATACTGTGTACATTATCTTGAGGATGTAGGTTCTTTTGAATACACTCGT AATACCCTTAAAGAGCTTGAAGCTAAAGCCTATAAACAGATTGATGCACGTGGTGGGAACCCTGAGCTA GTAGCCTTAGTAAAACACTTAAGTAAGATGTTCAAAGAAGAAAATGAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037278 |
Insert Size | 741 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001037278.1 |
RefSeq Size | 2828 bp |
RefSeq ORF | 741 bp |
Locus ID | 9453 |
Protein Pathways | Metabolic pathways, Terpenoid backbone biosynthesis |
MW | 28.4 kDa |
Gene Summary | This gene is a member of the prenyltransferase family and encodes a protein with geranylgeranyl diphosphate (GGPP) synthase activity. The enzyme catalyzes the synthesis of GGPP from farnesyl diphosphate and isopentenyl diphosphate. GGPP is an important molecule responsible for the C20-prenylation of proteins and for the regulation of a nuclear hormone receptor. Alternate transcriptional splice variants, both protein-coding and non-protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010] Transcript Variant: This variant (3) lacks an exon in the coding region, which results in initiation of translation at a downstream AUG. The resulting protein (isoform B) has a shorter N-terminus than isoform A. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216980 | GGPS1 (Myc-DDK-tagged)-Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 3 |
CNY 2,400.00 |
|
RC216980L3 | Lenti ORF clone of Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216980L4 | Lenti ORF clone of Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG216980 | GGPS1 (tGFP-tagged) - Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 3 |
CNY 4,370.00 |