GGPS1 (NM_001037278) Human Untagged Clone

CAT#: SC302872

GGPS1 (untagged)-Human geranylgeranyl diphosphate synthase 1 (GGPS1), transcript variant 3



  "NM_001037278" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
GGPS1 mouse monoclonal antibody, clone OTI3F9 (formerly 3F9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GGPPS; GGPPS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302872 representing NM_001037278.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTGCATAATGCCAGTTTACTCATCGATGATATTGAAGACAACTCAAAACTCCGACGTGGCTTTCCA
GTGGCCCACAGCATCTATGGAATCCCATCTGTCATCAATTCTGCCAATTACGTGTATTTCCTTGGCTTG
GAGAAAGTCTTAACCCTTGATCACCCAGATGCAGTGAAGCTTTTTACCCGCCAGCTTTTGGAACTCCAT
CAGGGACAAGGCCTAGATATTTACTGGAGGGATAATTACACTTGTCCCACTGAAGAAGAATATAAAGCT
ATGGTGCTGCAGAAAACAGGTGGACTGTTTGGATTAGCAGTAGGTCTCATGCAGTTGTTCTCTGATTAC
AAAGAAGATTTAAAACCGCTACTTAATACACTTGGGCTCTTTTTCCAAATTAGGGATGATTATGCTAAT
CTACACTCCAAAGAATATAGTGAAAACAAAAGTTTTTGTGAAGATCTGACAGAGGGAAAGTTCTCATTT
CCTACTATTCATGCTATTTGGTCAAGGCCTGAAAGCACCCAGGTGCAGAATATCTTGCGCCAGAGAACA
GAAAACATAGATATAAAAAAATACTGTGTACATTATCTTGAGGATGTAGGTTCTTTTGAATACACTCGT
AATACCCTTAAAGAGCTTGAAGCTAAAGCCTATAAACAGATTGATGCACGTGGTGGGAACCCTGAGCTA
GTAGCCTTAGTAAAACACTTAAGTAAGATGTTCAAAGAAGAAAATGAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001037278
Insert Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001037278.1
RefSeq Size 2828 bp
RefSeq ORF 741 bp
Locus ID 9453
Protein Pathways Metabolic pathways, Terpenoid backbone biosynthesis
MW 28.4 kDa
Gene Summary This gene is a member of the prenyltransferase family and encodes a protein with geranylgeranyl diphosphate (GGPP) synthase activity. The enzyme catalyzes the synthesis of GGPP from farnesyl diphosphate and isopentenyl diphosphate. GGPP is an important molecule responsible for the C20-prenylation of proteins and for the regulation of a nuclear hormone receptor. Alternate transcriptional splice variants, both protein-coding and non-protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Transcript Variant: This variant (3) lacks an exon in the coding region, which results in initiation of translation at a downstream AUG. The resulting protein (isoform B) has a shorter N-terminus than isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...