Dermokine (DMKN) (NM_001035516) Human Untagged Clone
CAT#: SC302840
DMKN (untagged)-Human dermokine (DMKN), transcript variant 1
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | UNQ729; ZD52F10 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001035516, the custom clone sequence may differ by one or more nucleotides
ATGAACATGAAGCCGGCCACTGCCTCTGCTCTGCTCCTGCTCCTGCTGGGCCTGGCCTGG ACCCAGGGGAGCCACGGCTGGGGTGCGGACGCGTCATCACTGCAGAAACGTGCAGGCAGA GCCGATCAGAACTACAATTACAACCAGCATGCGTATCCCACTGCCTATGGTGGGAAGTAC TCAGTCAAGACCCCTGCAAAGGGGGGAGTCTCACCTTCTTCCTCGGCTTCCCGGGTGCAA CCTGGCCTGCTGCAGTGGGTGAAGTTTTGGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001035516 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001035516.1, NP_001030593.1 |
RefSeq Size | 607 bp |
RefSeq ORF | 273 bp |
Locus ID | 93099 |
Gene Summary | This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (1) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 2. The encoded isoform (1, also referred to as isoform alpha) has a distinct N-terminus and is shorter than isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211509 | DMKN (Myc-DDK-tagged)-Human dermokine (DMKN), transcript variant 1 |
CNY 3,990.00 |
|
RC211509L3 | Lenti-ORF clone of DMKN (Myc-DDK-tagged)-Human dermokine (DMKN), transcript variant 1 |
CNY 5,890.00 |
|
RC211509L4 | Lenti-ORF clone of DMKN (mGFP-tagged)-Human dermokine (DMKN), transcript variant 1 |
CNY 5,890.00 |
|
RG211509 | DMKN (tGFP-tagged) - Human dermokine (DMKN), transcript variant 1 |
CNY 4,370.00 |