KCNIP4 (NM_001035003) Human Untagged Clone

CAT#: SC302821

KCNIP4 (untagged)-Human Kv channel interacting protein 4 (KCNIP4), transcript variant 5



  "NM_001035003" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


KCNIP4 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CALP; KCHIP4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001035003, the custom clone sequence may differ by one or more nucleotides
ATGAGTGGCTGTAGAAAGCGGTGTAAACGTGAAATACTGAAATTTGCCCAGTACCTTCTC
AGACTATTAACAGGTTCTCTTCATACAGACAGCGTGGAAGATGAACTGGAGATGGCCACC
GTCAGGCATCGGCCTGAAGCCCTTGAGCTTCTGGAAGCCCAGAGCAAATTTACCAAGAAA
GAGCTTCAGATCCTTTACAGAGGATTTAAGAATGAATGCCCCAGTGGTGTTGTTAATGAA
GAAACCTTCAAAGAGATTTACTCGCAGTTCTTTCCACAGGGAGACTCTACAACATATGCA
CATTTTCTGTTCAATGCATTTGATACAGACCACAATGGAGCTGTGAGTTTCGAGGATTTC
ATCAAAGGTCTTTCCATTTTGCTCCGGGGGACAGTACAAGAAAAACTCAATTGGGCATTT
AATCTGTATGACATAAATAAAGATGGCTACATCACTAAAGAGGAAATGCTTGATATAATG
AAAGCAATATACGATATGATGGGTAAATGTACATATCCTGTCCTCAAAGAAGATGCTCCC
AGACAACACGTTGAAACATTTTTTCAGAAAATGGACAAAAATAAAGATGGGGTTGTTACC
ATAGATGAGTTCATTGAAAGCTGCCAAAAAGATGAAAACATAATGCGCTCCATGCAGCTC
TTTGAAAATGTGATTTAA
Restriction Sites Please inquire     
ACCN NM_001035003
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001035003.1, NP_001030175.1
RefSeq Size 2424 bp
RefSeq ORF 678 bp
Locus ID 80333
UniProt ID Q6PIL6
Protein Families Druggable Genome, Ion Channels: Other
Gene Summary This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. This protein member also interacts with presenilin. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) has an alternate exon which contains an in-frame start codon, as compared to variant 1. The encoded isoform (5) thus has an alternate N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...