RPL3 (NM_001033853) Human Untagged Clone

CAT#: SC302771

RPL3 (untagged)-Human ribosomal protein L3 (RPL3), transcript variant 2



  "NM_001033853" in other vectors (4)

CNY 3,656.00

CNY 5,700.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RPL3 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASC-1; L3; TARBP-B
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001033853 edited
TTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACATGGGTCCCTCGGCTTCC
TGCCTCGGAAGCGCAGCAGCAGGCATCGTGGGAAGGTGAAGAGCTTCCCTAAGGATGACC
CATCCAAGCCGGTCCACCTCACAGCCTTCCTGGGATACAAGGCTGGCATGACTCACATCG
TGCGGGAAGTCGACAGGCCGGGATCCAAGGTGAACAAGAAGGAGGTGGTGGAGGCTGTGA
CCATTGTAGAGACACCACCCATGGTGGTTGTGGGCATTGTGGGCTACGTGGAAACCCCTC
GAGGCCTCCGGACCTTCAAGACTGTCTTTGCTGAGCACATCAGTGATGAATGCAAGAGGC
GTTTCTATAAGAATTGGCATAAATCTAAGAAGAAGGCCCACCTGATGGAGATCCAGGTGA
ACGGAGGCACTGTGGCCGAGAAGCTGGACTGGGCCCGCGAGAGGCTTGAGCAGCAGGTAC
CTGTGAACCAAGTGTTTGGGCAGGATGAGATGATCGACGTCATCGGGGTGACCAAGGGCA
AAGGCTACAAAGGGGTCACCAGTCGTTGGCACACCAAGAAGCTGCCCCGCAAGACCCACC
GAGGCCTGCGCAAGGTGGCCTGTATTGGGGCATGGCATCCTGCTCGTGTAGCCTTCTCTG
TGGCACGCGCTGGGCAGAAAGGCTACCATCACCGCACTGAGATCAACAAGAAGATTTATA
AGATTGGCCAGGGCTACCTTATCAAGGACGGCAAGCTGATCAAGAACAATGCCTCCACTG
ACTATGACCTATCTGACAAGAGCATCAACCCTCTGGGTGGCTTTGTCCACTATGGTGAAG
TGACCAATGACTTTGTCATGCTGAAAGGCTGTGTGGTGGGAACCAAGAAGCGGGTGCTCA
CCCTCCGCAAGTCCTTGCTGGTGCAGACGAAGCGGCGGGCTCTGGAGAAGATTGACCTTA
AGTTCATTGACACCACCTCCAAGTTTGGCCATGGCCGCTTCCAGACCATGGAGGAGAAGA
AAGCATTCATGGGACCACTGAAGAAAGACCGAATTGCAAAGGAAGAAGGAGCTTAATGCC
AGGAACAGATTTTGCAGTTGGTGGGGTCTCAATAAAAGTTATTTTCCACTGAAAAAAAAA
AAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001033853
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001033853.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001033853.1, NP_001029025.1
RefSeq Size 1201 bp
RefSeq ORF 1065 bp
Locus ID 6122
Protein Pathways Ribosome
Gene Summary Ribosomes, the complexes that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L3P family of ribosomal proteins and it is located in the cytoplasm. The protein can bind to the HIV-1 TAR mRNA, and it has been suggested that the protein contributes to tat-mediated transactivation. This gene is co-transcribed with several small nucleolar RNA genes, which are located in several of this gene's introns. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses alternate in-frame splice sites in two exons, compared to variant 1, resulting in a shorter protein (isoform b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...