DNAAF4 (NM_001033559) Human Untagged Clone

CAT#: SC302728

DYX1C1 (untagged)-Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 2



  "NM_001033559" in other vectors (4)

CNY 6,180.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Polyclonal Antibody against DYX1C1
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CILD25; DYX1; DYX1C1; DYXC1; EKN1; RD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302728 representing NM_001033559.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTCTTCAGGTTAGCGATTACAGCTGGCAGCAGACGAAGACTGCGGTCTTTCTGTCTCTGCCCCTC
AAAGGCGTGTGCGTCAGAGACACGGACGTGTTCTGCACGGAAAACTATCTGAAGGTCAACTTTCCTCCA
TTTTTATTTGAGGCATTTCTTTATGCTCCCATAGACGATGAGAGCAGCAAAGCAAAGATTGGGAATGAC
ACCATTGTCTTCACCTTGTATAAAAAAGAAGCGGCCATGTGGGAGACCCTTTCTGTGACGGGTGTTGAC
AAAGAGATGATGCAAAGAATTAGAGAAAAATCTATTTTACAAGCACAAGAGAGAGCAAAAGAAGCTACA
GAAGCAAAAGCTGCAGCAAAGCGGGAAGATCAAAAATACGCACTAAGTGTCATGATGAAGATTGAAGAA
GAAGAGAGGAAAAAAATAGAAGATATGAAAGAAAATGAACGGATAAAAGCCACTAAAGCATTGGAAGCC
TGGAAAGAATATCAAAGAAAAGCTGAGGAGCAAAAAAAAATTCAGAGAGAAGAGAAATTATGTCAAAAA
GAAAAGCAAATTAAAGAAGAAAGAAAAAAAATAAAATATAAGAGTCTTACTAGAAATTTGGCATCTAGA
AATCTTGCTCCAAAAGGGAGAAATTCAGAAAATATATTTACTGAGAAGTTAAAGGAAGACAGTATTCCT
GCTCCTCGCTCTGTTGGCAGTATTAAAATCAACTTTACCCCTCGAGTATTCCCAACAGCTCTTCGTGAA
TCACAAGTAGCAGAAGAGGAGGAGTGGCTACACAAACAAGCTGAGGCACGAAGAGCAATGAATACTGAC
ATAGCTGAACTTTGCGATTTAAAAGAAGAAGAAAAGAACCCAGAATGGTTGAAGGATAAAGGAAACAAA
TTGTTTGCAACGGAAAACTATTTGGCAGCTATCAATGCATATAATTTAGCCATAAGACTAAATAATAAG
ATGCCACTATTGTATTTGAACCGGGCTGCTTGCCACCTAAAACTAAAAAACTTACACAAGGCTATTGAA
GATTCTTCTAAGGCCTACAGGATTATGAAGCGGCACTTAAGATTGATCCATCCAACAAAATTGTACAAA
TTGATGCTGAGAAGATTCGGAATGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001033559
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001033559.2
RefSeq Size 1905 bp
RefSeq ORF 1131 bp
Locus ID 161582
UniProt ID Q8WXU2
MW 44 kDa
Gene Summary This gene encodes a tetratricopeptide repeat domain-containing protein. The encoded protein interacts with estrogen receptors and the heat shock proteins, Hsp70 and Hsp90. An homologous protein in rat has been shown to function in neuronal migration in the developing neocortex. A chromosomal translocation involving this gene is associated with a susceptibility to developmental dyslexia. Mutations in this gene are associated with deficits in reading and spelling. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream cell cycle progression 1 (CCPG1) gene. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (2) lacks an alternate exon that causes a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (b) has a distinct and shorter C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...