AIPL1 (NM_001033054) Human Untagged Clone

CAT#: SC302689

AIPL1 (untagged)-Human aryl hydrocarbon receptor interacting protein-like 1 (AIPL1), transcript variant 2



  "NM_001033054" in other vectors (4)

CNY 6,270.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
AIPL1 mouse monoclonal antibody, clone OTI3B4 (formerly 3B4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AIPL2; LCA4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001033054, the custom clone sequence may differ by one or more nucleotides
ATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAAACCATTCTGCACGGGGGC
ACGGGCGAGCTCCCAAACTTCATCACCGGATCCCGAGTGATCTTTCATTTCCGCACCATG
AAATGTGATGAGGAGCGGACAGTCATTGACGACAGTCGGCAGGTGGGCCAGCCCATGCAC
ATCATCATCGGAAACATGTTCAAGCTCGAGGTCTGGGAGATCCTGCTTACCTCCATGCGG
GTGCACGAGGTGGCCGAGTTCTGGTGCGACACCATCGTTGATGCCCCGAGTGATTACCAG
AGGGAGACCTGGAACCTGAGCAATCATGAGAAGATGAAGGCGGTGCCCGTCCTCCACGGA
GAGGGAAATCGGCTCTTCAAGCTGGGCCGCTACGAGGAGGCCTCTTCCAAGTACCAGGAG
GCCATCATCTGCCTAAGGAACCTGCAGACCAAGGAGAAGCCATGGGAGGTGCAGTGGCTG
AAGCTGGAGAAGATGATCAATACTCTGATCCTCAACTACTGCCAGTGCCTGCTGAAGAAG
GAGGAGTACTATGAGGTGCTGGAGCACACCAGTGATATTCTCCGGCACCACCCAGGCATC
GTGAAGGCCTACTACGTGCGTGCCCGGGCTCACGCAGAGGTGTGGAATGAGGCCGAGGCC
AAGGCGGACCTCCAGAAAGTGCTGGAGCTGGAGCCGTCCATGCAGAAGGCGGTGCGCAGG
GAGCTGAGGCTGCTGGAGAACCGCATGGCGGAGAAGCAGGAGGAGGAGCGGCTGCGCTGC
CGGAACATGCTGAGCCAGGGTGCCACGCAGCCTCCCGCAGAGCCACCCACAGAGCCACCC
GCACAGTCATCCACAGAGCCACCTGCAGAGCCACCCACAGCACCATCTGCAGAGCTGTCC
GCAGGGCCCCCTGCAGAGCCAGCCACAGAGCCACCCCCGTCCCCAGGGCACTCGCTGCAG
CACTGA
Restriction Sites Please inquire     
ACCN NM_001033054
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001033054.1, NP_001028226.1
RefSeq Size 2792 bp
RefSeq ORF 966 bp
Locus ID 23746
UniProt ID Q9NZN9
Protein Families Druggable Genome
Gene Summary Leber congenital amaurosis (LCA) is the most severe inherited retinopathy with the earliest age of onset and accounts for at least 5% of all inherited retinal diseases. Affected individuals are diagnosed at birth or in the first few months of life with nystagmus, severely impaired vision or blindness and an abnormal or flat electroretinogram. The photoreceptor/pineal-expressed gene, AIPL1, encoding aryl-hydrocarbon interacting protein-like 1, is located within the LCA4 candidate region. The encoded protein contains three tetratricopeptide motifs, consistent with chaperone or nuclear transport activity. Mutations in this gene may cause approximately 20% of recessive LCA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. It encodes isoform 2, which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...