United States
Germany
Japan
United Kingdom
China
TFPI (NM_001032281) Human Untagged Clone
CAT＃: SC302621
TFPI (untagged)-Human tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) (TFPI), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | EPI; LACI; TFI; TFPI1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302621 representing NM_001032281.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATTTACACAATGAAGAAAGTACATGCACTTTGGGCTTCTGTATGCCTGCTGCTTAATCTTGCCCCT GCCCCTCTTAATGCTGATTCTGAGGAAGATGAAGAACACACAATTATCACAGATACGGAGTTGCCACCA CTGAAACTTATGCATTCATTTTGTGCATTCAAGGCGGATGATGGCCCATGTAAAGCAATCATGAAAAGA TTTTTCTTCAATATTTTCACTCGACAGTGCGAAGAATTTATATATGGGGGATGTGAAGGAAATCAGAAT CGATTTGAAAGTCTGGAAGAGTGCAAAAAAATGTGTACAAGAGATAATGCAAACAGGATTATAAAGACA ACATTGCAACAAGAAAAGCCAGATTTCTGCTTTTTGGAAGAAGATCCTGGAATATGTCGAGGTTATATT ACCAGGTATTTTTATAACAATCAGACAAAACAGTGTGAACGTTTCAAGTATGGTGGATGCCTGGGCAAT ATGAACAATTTTGAGACACTGGAAGAATGCAAGAACATTTGTGAAGATGGTCCGAATGGTTTCCAGGTG GATAATTATGGAACCCAGCTCAATGCTGTGAATAACTCCCTGACTCCGCAATCAACCAAGGTTCCCAGC CTTTTTGTTACAAAAGAAGGAACAAATGATGGTTGGAAGAATGCGGCTCATATTTACCAAGTCTTTCTG AACGCCTTCTGCATTCATGCATCCATGTTCTTTCTAGGATTGGATAGCATTTCATGCCTATGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001032281 |
| Insert Size | 756 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001032281.3 |
| RefSeq Size | 1179 bp |
| RefSeq ORF | 756 bp |
| Locus ID | 7035 |
| UniProt ID | P10646 |
| Protein Families | Secreted Protein |
| Protein Pathways | Complement and coagulation cascades |
| MW | 28.7 kDa |
| Gene Summary | This gene encodes a Kunitz-type serine protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. Inhibition of the encoded protein restores hemostasis in animal models of hemophilia. This gene encodes multiple protein isoforms that differ in their inhibitory activity, specificity and cellular localization. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (2) uses an alternate in-frame exon in the 3' coding region compared to variant 1. The encoded isoform (b, also known as TFPIbeta) has a shorter and distinct C-terminus, which includes a glycosylphosphatidylinositol (GPI) anchor attachment site, compared to isoform a. Variants 2 and 3 both encode the same isoform (b). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202098 | TFPI (Myc-DDK-tagged)-Human tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) (TFPI), transcript variant 2 |
CNY 2,400.00 |
|
| RC202098L3 | Lenti ORF clone of Human tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) (TFPI), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202098L4 | Lenti ORF clone of Human tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) (TFPI), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG202098 | TFPI (tGFP-tagged) - Human tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) (TFPI), transcript variant 2 |
CNY 4,000.00 |
