CD43 (SPN) (NM_001030288) Human Untagged Clone

CAT#: SC302510

SPN (untagged)-Human sialophorin (SPN), transcript variant 1



  "NM_001030288" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SPN (CD43) mouse monoclonal antibody, clone OTI6A4 (formerly 6A4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD43; GALGP; GPL115; LSN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302510 representing NM_001030288.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCACGCTTCTCCTTCTCCTTGGGGTGCTGGTGGTAAGCCCAGACGCTCTGGGGAGCACAACAGCA
GTGCAGACACCCACCTCCGGAGAGCCTTTGGTCTCTACTAGCGAGCCCCTGAGCTCAAAGATGTACACC
ACTTCAATAACAAGTGACCCTAAGGCCGACAGCACTGGGGACCAGACCTCAGCCCTACCTCCCTCAACT
TCCATCAATGAGGGATCCCCTCTTTGGACTTCCATTGGTGCCAGCACTGGTTCCCCTTTACCTGAGCCA
ACAACCTACCAGGAAGTTTCCATCAAGATGTCATCAGTGCCCCAGGAAACCCCTCATGCAACCAGTCAT
CCTGCTGTTCCCATAACAGCAAACTCTCTAGGATCCCACACCGTGACAGGTGGAACCATAACAACGAAC
TCTCCAGAAACCTCCAGTAGGACCAGTGGAGCCCCTGTTACCACGGCAGCTAGCTCTCTGGAGACCTCC
AGAGGCACCTCTGGACCCCCTCTTACCATGGCAACTGTCTCTCTGGAGACTTCCAAAGGCACCTCTGGA
CCCCCTGTTACCATGGCAACTGACTCTCTGGAGACCTCCACTGGGACCACTGGACCCCCTGTTACCATG
ACAACTGGCTCTCTGGAGCCCTCCAGCGGGGCCAGTGGACCCCAGGTCTCTAGCGTAAAACTATCTACA
ATGATGTCTCCAACGACCTCCACCAACGCAAGCACTGTGCCCTTCCGGAACCCAGATGAGAACTCACGA
GGCATGCTGCCAGTGGCTGTGCTTGTGGCCCTGCTGGCGGTCATAGTCCTCGTGGCTCTGCTCCTGCTG
TGGCGCCGGCGGCAGAAGCGGCGGACTGGGGCCCTCGTGCTGAGCAGAGGCGGCAAGCGTAACGGGGTG
GTGGACGCCTGGGCTGGGCCAGCCCAGGTCCCTGAGGAGGGGGCCGTGACAGTGACCGTGGGAGGGTCC
GGGGGCGACAAGGGCTCTGGGTTCCCCGATGGGGAGGGGTCTAGCCGTCGGCCCACGCTCACCACTTTC
TTTGGCAGACGGAAGTCTCGCCAGGGCTCCCTGGCGATGGAGGAGCTGAAGTCTGGGTCAGGCCCCAGC
CTCAAAGGGGAGGAGGAGCCACTGGTGGCCAGTGAGGATGGGGCTGTGGACGCCCCAGCTCCTGATGAG
CCCGAAGGGGGAGACGGGGCTGCCCCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001030288
Insert Size 1203 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001030288.2
RefSeq Size 6944 bp
RefSeq ORF 1203 bp
Locus ID 6693
UniProt ID P16150
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
MW 40.3 kDa
Gene Summary This gene encodes a highly sialylated glycoprotein that functions in antigen-specific activation of T cells, and is found on the surface of thymocytes, T lymphocytes, monocytes, granulocytes, and some B lymphocytes. It contains a mucin-like extracellular domain, a transmembrane region and a carboxy-terminal intracellular region. The extracellular domain has a high proportion of serine and threonine residues, allowing extensive O-glycosylation, and has one potential N-glycosylation site, while the carboxy-terminal region has potential phosphorylation sites that may mediate transduction of activation signals. Different glycoforms of this protein have been described. In stimulated immune cells, proteolytic cleavage of the extracellular domain occurs in some cell types, releasing a soluble extracellular fragment. Defects in expression of this gene are associated with Wiskott-Aldrich syndrome. [provided by RefSeq, Sep 2017]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...