TSPAN4 (NM_001025234) Human Untagged Clone
CAT#: SC302373
TSPAN4 (untagged)-Human tetraspanin 4 (TSPAN4), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NAG-2; NAG2; TETRASPAN; TM4SF7; TSPAN-4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302373 representing NM_001025234.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGCGCGCCTGCCTCCAGGCCGTCAAGTACCTCATGTTCGCCTTCAACCTGCTCTTCTGGCTGGGA GGCTGTGGCGTGCTGGGTGTCGGCATCTGGCTGGCCGCCACACAGGGGAGCTTCGCCACGCTGTCCTCT TCCTTCCCGTCCCTGTCGGCTGCCAACTTGCTCATCATCACCGGCGCCTTTGTCATGGCCATCGGCTTC GTGGGCTGCCTGGGTGCCATCAAGGAGAACAAGTGCCTCCTGCTCACTTTCTTCCTGCTGCTGCTGCTG GTGTTCCTGCTGGAGGCCACCATCGCCATCCTCTTCTTCGCCTACACGGACAAGATTGACAGGTATGCC CAGCAAGACCTGAAGAAAGGCTTGCACCTGTACGGCACGCAGGGCAACGTGGGCCTCACCAACGCCTGG AGCATCATCCAGACCGACTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTCGAGGTGTACAAC GCCACGCGGGTACCTGACTCCTGCTGCTTGGAGTTCAGTGAGAGCTGTGGGCTGCACGCCCCCGGCACC TGGTGGAAGGCGCCGTGCTACGAGACGGTGAAGGTGTGGCTTCAGGAGAACCTGCTGGCTGTGGGCATC TTTGGGCTGTGCACGGCGCTGGTGCAGATCCTGGGCCTGACCTTCGCCATGACCATGTACTGCCAAGTG GTCAAGGCAGACACCTACTGCGCGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001025234 |
Insert Size | 717 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001025234.1 |
RefSeq Size | 1443 bp |
RefSeq ORF | 717 bp |
Locus ID | 7106 |
UniProt ID | O14817 |
Protein Families | Transmembrane |
MW | 26.1 kDa |
Gene Summary | The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and is similar in sequence to its family member CD53 antigen. It is known to complex with integrins and other transmembrane 4 superfamily proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, 4, 5 and 6 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210590 | TSPAN4 (Myc-DDK-tagged)-Human tetraspanin 4 (TSPAN4), transcript variant 2 |
CNY 2,400.00 |
|
RC210590L3 | Lenti ORF clone of Human tetraspanin 4 (TSPAN4), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210590L4 | Lenti ORF clone of Human tetraspanin 4 (TSPAN4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG210590 | TSPAN4 (tGFP-tagged) - Human tetraspanin 4 (TSPAN4), transcript variant 2 |
CNY 4,370.00 |