Casein Kinase 1 alpha (CSNK1A1) (NM_001025105) Human Untagged Clone
CAT#: SC302351
CSNK1A1 (untagged)-Human casein kinase 1, alpha 1 (CSNK1A1), transcript variant 1
CNY 3,656.00
CNY 5,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CK1; CK1a; CKIa; HEL-S-77p; HLCDGP1; PRO2975 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001025105 edited
ATGGCGAGTAGCAGCGGCTCCAAGGCTGAATTCATTGTCGGAGGGAAATATAAACTGGTA CGGAAGATCGGGTCTGGCTCCTTCGGGGACATCTATTTGGCGATCAACATCACCAACGGC GAGGAAGTGGCAGTGAAGCTAGAATCTCAGAAGGCCAGGCATCCCCAGTTGCTGTACGAG AGCAAGCTCTATAAGATTCTTCAAGGTGGGGTTGGCATCCCCCACATACGGTGGTATGGT CAGGAAAAAGACTACAATGTACTAGTCATGGATCTTCTGGGACCTAGCCTCGAAGACCTC TTCAATTTCTGTTCAAGAAGGTTCACAATGAAAACTGTACTTATGTTAGCTGACCAGATG ATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATTAAACCAGAT AACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTGTTTAGAATCTCCAGTGGGGAAG AGGAAAAGAAGCATGACTGTTAGTACTTCTCAGGACCCATCTTTCTCAGGATTAAACCAG TTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACAAGGCAACAC ATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATATGCTAGCATCAATGCA CATCTTGGTATTGAGCAGAGTCGCCGAGATGACATGGAATCATTAGGATATGTTTTGATG TATTTTAATAGAACCAGCCTGCCATGGCAAGGGCTAAAGGCTGCAACAAAGAAACAAAAA TATGAAAAGATTAGTGAAAAGAAGATGTCCACGCCTGTTGAAGTTTTATGTAAGGGGTTT CCTGCAGAATTTGCGATGTACTTAAACTATTGTCGTGGGCTACGCTTTGAGGAAGCCCCA GATTACATGTATCTGAGGCAGCTATTCCGCATTCTTTTCAGGACCCTGAACCATCAATAT GACTACACATTTGATTGGACAATGTTAAAGCAGAAAGCAGCACAGCAGGCAGCCTCTTCC AGTGGGCAGGGTCAGCAGGCCCAAACCCCCACAGGCAAGCAAACTGACAAAACCAAGAGT AACATGAAAGGTTTCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001025105 |
Insert Size | 1900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001025105.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001025105.1, NP_001020276.1 |
RefSeq Size | 3149 bp |
RefSeq ORF | 1098 bp |
Locus ID | 1452 |
UniProt ID | P48729 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase |
Protein Pathways | Hedgehog signaling pathway, Wnt signaling pathway |
Gene Summary | Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. It can phosphorylate a large number of proteins. Participates in Wnt signaling. Phosphorylates CTNNB1 at 'Ser-45'. May phosphorylate PER1 and PER2. May play a role in segregating chromosomes during mitosis (PubMed:11955436, PubMed:1409656, PubMed:18305108). May play a role in keratin cytoskeleton disassembly and thereby, it may regulate epithelial cell migration (PubMed:23902688).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217936 | CSNK1A1 (Myc-DDK-tagged)-Human casein kinase 1, alpha 1 (CSNK1A1), transcript variant 1 |
CNY 3,656.00 |
|
RC217936L1 | Lenti ORF clone of Human casein kinase 1, alpha 1 (CSNK1A1), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC217936L2 | Lenti ORF clone of Human casein kinase 1, alpha 1 (CSNK1A1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC217936L3 | Lenti ORF clone of Human casein kinase 1, alpha 1 (CSNK1A1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC217936L4 | Lenti ORF clone of Human casein kinase 1, alpha 1 (CSNK1A1), transcript variant 1, mGFP tagged |
CNY 6,056.00 |
|
RG217936 | CSNK1A1 (tGFP-tagged) - Human casein kinase 1, alpha 1 (CSNK1A1), transcript variant 1 |
CNY 5,256.00 |
其它Casein Kinase 1 alpha产品