CCXCR1 (XCR1) (NM_001024644) Human Untagged Clone

CAT#: SC302272

XCR1 (untagged)-Human chemokine (C motif) receptor 1 (XCR1), transcript variant 2



  "NM_001024644" in other vectors (4)

CNY 4,024.00

CNY 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
XCR1 Rabbit Polyclonal (C-Terminus) Antibody
    • 50 ug

CNY 5,654.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CCXCR1; GPR5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302272 representing NM_001024644.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGTCCTCAGGCAACCCAGAGAGCACCACCTTTTTTTACTATGACCTTCAGAGCCAGCCGTGTGAG
AACCAGGCCTGGGTCTTTGCTACCCTCGCCACCACTGTCCTATACTGCCTGGTGTTTCTCCTCAGCCTA
GTGGGCAACAGCCTGGTCCTGTGGGTCCTGGTGAAGTATGAGAGCCTGGAGTCCCTCACCAACATCTTC
ATCCTCAACCTGTGCCTCTCAGACCTGGTGTTCGCCTGCTTGTTGCCTGTGTGGATCTCCCCATACCAC
TGGGGCTGGGTGCTGGGAGACTTCCTCTGCAAACTCCTCAATATGATCTTCTCCATCAGCCTCTACAGC
AGCATCTTCTTCCTGACCATCATGACCATCCACCGCTACCTGTCGGTAGTGAGCCCCCTCTCCACCCTG
CGCGTCCCCACCCTCCGCTGCCGGGTGCTGGTGACCATGGCTGTGTGGGTAGCCAGCATCCTGTCCTCC
ATCCTCGACACCATCTTCCACAAGGTGCTTTCTTCGGGCTGTGATTATTCCGAACTCACGTGGTACCTC
ACCTCCGTCTACCAGCACAACCTCTTCTTCCTGCTGTCCCTGGGGATTATCCTGTTCTGCTACGTGGAG
ATCCTCAGGACCCTGTTCCGCTCACGCTCCAAGCGGCGCCACCGCACGGTCAAGCTCATCTTCGCCATC
GTGGTGGCCTACTTCCTCAGCTGGGGTCCCTACAACTTCACCCTGTTTCTGCAGACGCTGTTTCGGACC
CAGATCATCCGGAGCTGCGAGGCCAAACAGCAGCTAGAATACGCCCTGCTCATCTGCCGCAACCTCGCC
TTCTCCCACTGCTGCTTTAACCCGGTGCTCTATGTCTTCGTGGGGGTCAAGTTCCGCACACACCTGAAA
CATGTTCTCCGGCAGTTCTGGTTCTGCCGGCTGCAGGCACCCAGCCCAGCCTCGATCCCCCACTCCCCT
GGTGCCTTCGCCTATGAGGGCGCCTCCTTCTACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001024644
Insert Size 1002 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001024644.1
RefSeq Size 1251 bp
RefSeq ORF 1002 bp
Locus ID 2829
UniProt ID P46094
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
MW 38.5 kDa
Gene Summary The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. The family members are characterized by the presence of 7 transmembrane domains and numerous conserved amino acids. This receptor is most closely related to RBS11 and the MIP1-alpha/RANTES receptor. It transduces a signal by increasing the intracellular calcium ions level. The viral macrophage inflammatory protein-II is an antagonist of this receptor and blocks signaling. Several alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2020]
Transcript Variant: This variant (2) lacks an exon in the 5' UTR, as compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...