SPRR2E (NM_001024209) Human Untagged Clone
CAT#: SC302231
SPRR2E (untagged)-Human small proline-rich protein 2E (SPRR2E)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302231 representing NM_001024209.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTTATCAACAGCAGCAGTGCAAGCAGCCCTGCCAGCCACCTCCTGTGTGCCCCACGCCAAAGTGC CCAGAGCCATGTCCACCCCCGAAGTGCCCTGAGCCCTGCCCACCACCAAAGTGTCCACAGCCCTGCCCA CCTCAGCAGTGCCAGCAAAAATGTCCTCCTGTGACACCTTCCCCACCCTGCCAGCCAAAGTGTCCACCC AAGAGCAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001024209 |
Insert Size | 219 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001024209.3 |
RefSeq Size | 693 bp |
RefSeq ORF | 219 bp |
Locus ID | 6704 |
UniProt ID | P22531 |
MW | 7.9 kDa |
Gene Summary | This gene encodes a member of a family of small proline-rich proteins clustered in the epidermal differentiation complex on chromosome 1q21. The encoded protein, along with other family members, is a component of the cornified cell envelope that forms beneath the plasma membrane in terminally differentiated stratified squamous epithelia. This envelope serves as a barrier against extracellular and environmental factors. The seven SPRR2 genes (A-G) appear to have been homogenized by gene conversion compared to others in the cluster that exhibit greater differences in protein structure. [provided by RefSeq, Feb 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221721 | SPRR2E (Myc-DDK-tagged)-Human small proline-rich protein 2E (SPRR2E) |
CNY 1,200.00 |
|
RC221721L1 | Lenti ORF clone of Human small proline-rich protein 2E (SPRR2E), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC221721L2 | Lenti ORF clone of Human small proline-rich protein 2E (SPRR2E), mGFP tagged |
CNY 5,890.00 |
|
RC221721L3 | Lenti ORF clone of Human small proline-rich protein 2E (SPRR2E), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221721L4 | Lenti ORF clone of Human small proline-rich protein 2E (SPRR2E), mGFP tagged |
CNY 5,890.00 |
|
RG221721 | SPRR2E (tGFP-tagged) - Human small proline-rich protein 2E (SPRR2E) |
CNY 2,800.00 |