HNMT (NM_001024075) Human Untagged Clone
CAT#: SC302229
HNMT (untagged)-Human histamine N-methyltransferase (HNMT), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HMT; HNMT-S1; HNMT-S2; MRT51 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001024075, the custom clone sequence may differ by one or more nucleotides
ATGGCATCTTCCATGAGGAGCTTGTTTTCTGACCACGGGAAATATGTTGAATCTTTCCGG AGGTTTCTCAACCATTCCACGGAACACCAGTGCATGCAGGAATTCATGGACAAGAAGCTG CCAGGCATAATAGGAAGGATTGGAGACACAAAATCAGAAATTAAGATTCTAAGCATAGGC GGAGGTGCAGATTGTCTCATTCGGGGAAGCTCCAGGGTTCTCAAGCGGAATTCGTGTTTC ATTTTGTGTAGCACCCGTCAGAAAGACAAGCCAGGCATGAGGATCCATGATGAGCGCTCT TCTGAGTTGCCATTTGGAGCTGCCCGTTTAGAAAGCAAATCTGCATTTCCCTCATTCCTA GTTTCCTTCATCCTCTTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001024075 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001024075.1, NP_001019246.1 |
RefSeq Size | 907 bp |
RefSeq ORF | 381 bp |
Locus ID | 3176 |
UniProt ID | P50135 |
Protein Families | Druggable Genome |
Protein Pathways | Histidine metabolism |
Gene Summary | In mammals, histamine is metabolized by two major pathways: N(tau)-methylation via histamine N-methyltransferase and oxidative deamination via diamine oxidase. This gene encodes the first enzyme which is found in the cytosol and uses S-adenosyl-L-methionine as the methyl donor. In the mammalian brain, the neurotransmitter activity of histamine is controlled by N(tau)-methylation as diamine oxidase is not found in the central nervous system. A common genetic polymorphism affects the activity levels of this gene product in red blood cells. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3), also called HNMT-S, includes an alternate exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224361 | HNMT (Myc-DDK-tagged)-Human histamine N-methyltransferase (HNMT), transcript variant 3 |
CNY 3,990.00 |
|
RC224361L3 | Lenti-ORF clone of HNMT (Myc-DDK-tagged)-Human histamine N-methyltransferase (HNMT), transcript variant 3 |
CNY 5,890.00 |
|
RC224361L4 | Lenti-ORF clone of HNMT (mGFP-tagged)-Human histamine N-methyltransferase (HNMT), transcript variant 3 |
CNY 5,890.00 |
|
RG224361 | HNMT (tGFP-tagged) - Human histamine N-methyltransferase (HNMT), transcript variant 3 |
CNY 4,370.00 |