GTP cyclohydrolase 1 (GCH1) (NM_001024070) Human Untagged Clone

CAT#: SC302226

GCH1 (untagged)-Human GTP cyclohydrolase 1 (GCH1), transcript variant 3



  "NM_001024070" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
GCH1 mouse monoclonal antibody,clone OTI5A1
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DYT5; DYT5a; DYT14; GCH; GTP-CH-1; GTPCH1; HPABH4B
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001024070, the custom clone sequence may differ by one or more nucleotides
ATGGAGAAGGGCCCTGTGCGGGCACCGGCGGAGAAGCCGCGGGGCGCCAGGTGCAGCAAT
GGGTTCCCCGAGCGGGATCCGCCGCGGCCCGGGCCCAGCAGGCCGGCGGAGAAGCCCCCG
CGGCCCGAGGCCAAGAGCGCGCAGCCCGCGGACGGCTGGAAGGGCGAGCGGCCCCGCAGC
GAGGAGGATAACGAGCTGAACCTCCCTAACCTGGCAGCCGCCTACTCGTCCATCCTGAGC
TCGCTGGGCGAGAACCCCCAGCGGCAAGGGCTGCTCAAGACGCCCTGGAGGGCGGCCTCG
GCCATGCAGTTCTTCACCAAGGGCTACCAGGAGACCATCTCAGATGTCCTAAACGATGCT
ATATTTGATGAAGATCATGATGAGATGGTGATTGTGAAGGACATAGACATGTTTTCCATG
TGTGAGCATCACTTGGTTCCATTTGTTGGAAAGGTCCATATTGGTTATCTTCCTAACAAG
CAAGTCCTTGGCCTCAGCAAACTTGCGAGGATTGTAGAAATCTATAGTAGAAGACTACAA
GTTCAGGAGCGCCTTACAAAACAAATTGCTGTAGCAATCACGGAAGCCTTGCGGCCTGCT
GGAGTCGGGGTAGTGGTTGAAGCAACGAAGTCAAATAAATATAATAAAGGGTTGAGCCCT
CTACTTTCTTCTTGCCACCTTTTTGTGGCAATATTAAAGTGA
Restriction Sites Please inquire     
ACCN NM_001024070
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001024070.1, NP_001019241.1
RefSeq Size 1940 bp
RefSeq ORF 702 bp
Locus ID 2643
UniProt ID P30793
Protein Families Druggable Genome
Protein Pathways Folate biosynthesis, Metabolic pathways
Gene Summary This gene encodes a member of the GTP cyclohydrolase family. The encoded protein is the first and rate-limiting enzyme in tetrahydrobiopterin (BH4) biosynthesis, catalyzing the conversion of GTP into 7,8-dihydroneopterin triphosphate. BH4 is an essential cofactor required by aromatic amino acid hydroxylases as well as nitric oxide synthases. Mutations in this gene are associated with malignant hyperphenylalaninemia and dopa-responsive dystonia. Several alternatively spliced transcript variants encoding different isoforms have been described; however, not all variants give rise to a functional enzyme. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3), also known as Type IV, uses alternate, in-frame splice sites in the 3' coding region and 3' UTR, compared to variant 1. The resulting non-functional protein (isoform 2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...