NME2 (NME1-NME2) (NM_001018136) Human Untagged Clone

CAT#: SC302195

NME1 (untagged)-Human NME1-NME2 readthrough (NME1-NME2), transcript variant 1



  "NM_001018136" in other vectors (5)

CN¥ 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


NME2 rabbit polyclonal antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NM23-LV; NMELV
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001018136, the custom clone sequence may differ by one or more nucleotides
ATGGCCAACTGTGAGCGTACCTTCATTGCGATCAAACCAGATGGGGTCCAGCGGGGTCTT
GTGGGAGAGATTATCAAGCGTTTTGAGCAGAAAGGATTCCGCCTTGTTGGTCTGAAATTC
ATGCAAGCTTCCGAAGATCTTCTCAAGGAACACTACGTTGACCTGAAGGACCGTCCATTC
TTTGCCGGCCTGGTGAAATACATGCACTCAGGGCCGGTAGTTGCCATGGTCTGGGAGGGG
CTGAATGTGGTGAAGACGGGCCGAGTCATGCTCGGGGAGACCAACCCTGCAGACTCCAAG
CCTGGGACCATCCGTGGAGACTTCTGCATACAAGTTGGCAGGACCATGGCCAACCTGGAG
CGCACCTTCATCGCCATCAAGCCGGACGGCGTGCAGCGCGGCCTGGTGGGCGAGATCATC
AAGCGCTTCGAGCAGAAGGGATTCCGCCTCGTGGCCATGAAGTTCCTCCGGGCCTCTGAA
GAACACCTGAAGCAGCACTACATTGACCTGAAAGACCGACCATTCTTCCCTGGGCTGGTG
AAGTACATGAACTCAGGGCCGGTTGTGGCCATGGTCTGGGAGGGGCTGAACGTGGTGAAG
ACAGGCCGAGTGATGCTTGGGGAGACCAATCCAGCAGATTCAAAGCCAGGCACCATTCGT
GGGGACTTCTGCATTCAGGTTGGCAGGAACATCATTCATGGCAGTGATTCAGTAAAAAGT
GCTGAAAAAGAAATCAGCCTATGGTTTAAGCCTGAAGAACTGGTTGACTACAAGTCTTGT
GCTCATGACTGGGTCTATGAATAA
Restriction Sites Please inquire     
ACCN NM_001018136
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001018136.1, NP_001018146.1
RefSeq Size 1107 bp
RefSeq ORF 1092 bp
Locus ID 654364
UniProt ID P22392
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways Metabolic pathways, Purine metabolism, Pyrimidine metabolism
Gene Summary This locus represents naturally occurring read-through transcription between the neighboring NME1 and NME2 genes. The significance of this read-through transcription and the function of the resulting protein product have not yet been determined. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (1) represents the shorter transcript but encodes the supported protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...