POLR3H (NM_001018052) Human Untagged Clone

CAT#: SC302142

POLR3H (untagged)-Human polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) (POLR3H), transcript variant 2



  "NM_001018052" in other vectors (4)

CN¥ 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
POLR3H mouse monoclonal antibody,clone OTI4D8
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C25; RPC8; RPC22.9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302142 representing NM_001018052.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGGAAGCTCAAC
GACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTACAACGTGGGACTCTGCATT
TGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTCCCTGGGGATGGCGCATCACACACCAAA
GTCTCTCTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTCGAC
GAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTCTACATGGACACC
GGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACGTCCCCCACAGGGCCCAGCTCA
GCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAGGAGGCTCCGTACACGCTTGTGGGATCCATC
AGTGAGCCAGGCCTGGGCCTTCTCTCCTGGTGGACCAGCAACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001018052
Insert Size 528 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001018052.3
RefSeq Size 4405 bp
RefSeq ORF 528 bp
Locus ID 171568
UniProt ID Q9Y535
Protein Families Transcription Factors
Protein Pathways Cytosolic DNA-sensing pathway, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
MW 19.7 kDa
Gene Summary DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Specific peripheric component of RNA polymerase III which synthesizes small RNAs, such as 5S rRNA and tRNAs. Plays a key role in sensing and limiting infection by intracellular bacteria and DNA viruses. Acts as nuclear and cytosolic DNA sensor involved in innate immune response. Can sense non-self dsDNA that serves as template for transcription into dsRNA. The non-self RNA polymerase III transcripts, such as Epstein-Barr virus-encoded RNAs (EBERs) induce type I interferon and NF- Kappa-B through the RIG-I pathway (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and lacks an alternate in-frame exon, compared to variant 1. The encoded isoform (b) is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...