United States
Germany
Japan
United Kingdom
China
AK6 (NM_001015891) Human Untagged Clone
CAT＃: SC302013
TAF9 (untagged)-Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AD-004; CGI-137; CINAP; CIP; hCINAP |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302013 representing NM_001015891.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGTCATCGAAAGCCAGGTACACCAGGGGTTGGAAAAACCACACTAGGCAAAGAACTTGCGTCAAAA TCAGGACTGAAATACATTAATGTGGGTGATTTAGCTCGAGAAGAGCAATTGTATGATGGCTATGATGAA GAGTATGACTGTCCCATTTTAGATGAAGACAGAGTAGTTGATGAGTTAGATAACCAAATGAGAGAAGGT GGAGTTATTGTTGATTACCATGGTTGTGATTTCTTCCCTGAACGCTGGTTTCATATAGTTTTTGTGCTG AGAACAGATACCAATGTATTGTACGAAAGACTTGAAACAAGGGGTTATAATGAGAAGAAACTAACAGAC AATATTCAGTGTGAGATTTTTCAAGTTCTTTATGAAGAAGCCACAGCATCCTACAAGGAAGAAATCGTG CATCAGCTGCCCAGTAATAAACCAGAAGAGCTAGAAAATAATGTAGATCAGATCTTGAAATGGATTGAG CAGTGGATCAAAGATCATAACTCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001015891 |
| Insert Size | 510 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001015891.1 |
| RefSeq Size | 1199 bp |
| RefSeq ORF | 510 bp |
| Locus ID | 102157402 |
| UniProt ID | Q9Y3D8 |
| MW | 19.8 kDa |
| Gene Summary | This gene encodes a protein that belongs to the adenylate kinase family of enzymes. The protein has a nuclear localization and contains Walker A (P-loop) and Walker B motifs and a metal-coordinating residue. The protein may be involved in regulation of Cajal body formation. In human, AK6 and TAF9 (GeneID: 6880) are two distinct genes that share 5' exons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (3) contains an alternate exon in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 2. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform b. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214780 | TAF9 (Myc-DDK-tagged)-Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 3 |
CNY 2,400.00 |
|
| RC214780L3 | Lenti ORF clone of Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC214780L4 | Lenti ORF clone of Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG214780 | TAF9 (tGFP-tagged) - Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa (TAF9), transcript variant 3 |
CNY 4,370.00 |
