LAT (NM_001014989) Human Untagged Clone
CAT#: SC301979
LAT (untagged)-Human linker for activation of T cells (LAT), transcript variant 4
CNY 6,270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IMD52; LAT1; pp36 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001014989, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCCACGGCTGCCAGCTGGCAGGTGGCTGTCCCCGTCTTGGGGGGGGCCAGCAGA CCCTTGGGGCCTAGGGGTGCAGCCAGCCTGCTCCGAGCTCCCCTGCAGATGGAGGAGGCC ATCCTGGTCCCCTGCGTGCTGGGGCTCCTGCTGCTGCCCATCCTGGCCATGTTGATGGCA CTGTGTGTGCACTGCCACAGACTGCCAGGCTCCTACGACAGCACATCCTCAGATAGTTTG TATCCAAGGGGCATCCAGTTCAAACGGCCTCACACGGTTGCCCCCTGGCCACCTGCCTAC CCACCTGTCACCTCCTACCCACCCCTGAGCCAGCCAGACCTGCTCCCCATCCCAAGATCC CCGCAGCCCCTTGGGGGCTCCCACCGGACGCCATCTTCCCGGCGGGATTCTGATGGTGCC AACAGTGTGGCGAGCTACGAGAACGAGGAACCAGCCTGTGAGGATGCGGATGAGGATGAG GACGACTATCACAACCCAGGCTACCTGGTGGTGCTTCCTGACAGCACCCCGGCCACTAGC ACTGCTGCCCCATCAGCTCCTGCACTCAGCACCCCTGGCATCCGAGACAGTGCCTTCTCC ATGGAGTCCATTGATGATTACGTGAACGTTCCGGAGAGCGGGGAGAGCGCAGAAGCGTCT CTGGATGGCAGCCGGGAGTATGTGAATGTGTCCCAGGAACTGCATCCTGGAGCGGCTAAG ACTGAGCCTGCCGCCCTGAGTTCCCAGGAGGCAGAGGAAGTGGAGGAAGAGGGGGCTCCA GATTACGAGAATCTGCAGGAGCTGAACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001014989 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001014989.1, NP_001014989.2 |
RefSeq Size | 1472 bp |
RefSeq ORF | 810 bp |
Locus ID | 27040 |
UniProt ID | O43561 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway |
Gene Summary | The protein encoded by this gene is phosphorylated by ZAP-70/Syk protein tyrosine kinases following activation of the T-cell antigen receptor (TCR) signal transduction pathway. This transmembrane protein localizes to lipid rafts and acts as a docking site for SH2 domain-containing proteins. Upon phosphorylation, this protein recruits multiple adaptor proteins and downstream signaling molecules into multimolecular signaling complexes located near the site of TCR engagement. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) encodes the longest isoform (d). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212487 | LAT (Myc-DDK-tagged)-Human linker for activation of T cells (LAT), transcript variant 4 |
CNY 3,990.00 |
|
RC212487L3 | Lenti-ORF clone of LAT (Myc-DDK-tagged)-Human linker for activation of T cells (LAT), transcript variant 4 |
CNY 5,890.00 |
|
RC212487L4 | Lenti-ORF clone of LAT (mGFP-tagged)-Human linker for activation of T cells (LAT), transcript variant 4 |
CNY 5,890.00 |
|
RG212487 | LAT (tGFP-tagged) - Human linker for activation of T cells (LAT), transcript variant 4 |
CNY 4,370.00 |