AGPAT2 (NM_001012727) Human Untagged Clone
CAT#: SC301710
AGPAT2 (untagged)-Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 1-AGPAT2; BSCL; BSCL1; LPAAB; LPAAT-beta |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301710 representing NM_001012727.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGCTGTGGCCGTGTCTGGCCGCGGCGCTGCTGTTGCTGCTGCTGCTGGTGCAGCTGAGCCGCGCG GCCGAGTTCTACGCCAAGGTCGCCCTGTACTGCGCGCTGTGCTTCACGGTGTCCGCCGTGGCCTCGCTC GTCTGCCTGCTGCGCCACGGCGGCCGGACGGTGGAGAACATGAGCATCATCGGCTGGTTCGTGCGAAGC TTCAAGTACTTTTACGGGCTCCGCTTCGAGGTGCGGGACCCGCGCAGGCTGCAGGAGGCCCGTCCCTGT GTCATCGTCTCCAACCACCAGAGCATCCTGGACATGATGGGCCTCATGGAGGTCCTTCCGGAGCGCTGC GTGCAGATCGCCAAGCGGGAGCTGCTCTTCCTGGGGCCCGTGGGCCTCATCATGTACCTCGGGGGCGTC TTCTTCATCAACCGGCAGCGCTCTAGCACTGCCATGACAGTGATGGCCGACCTGGGCGAGCGCATGGTC AGGGAGAACGTGCCCATCGTCCCCGTGGTGTACTCTTCCTTCTCCTCCTTCTACAACACCAAGAAGAAG TTCTTCACTTCAGGAACAGTCACAGTGCAGGTGCTGGAAGCCATCCCCACCAGCGGCCTCACTGCGGCG GACGTCCCTGCGCTCGTGGACACCTGCCACCGGGCCATGAGGACCACCTTCCTCCACATCTCCAAGACC CCCCAGGAGAACGGGGCCACTGCGGGGTCTGGCGTGCAGCCGGCCCAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001012727 |
Insert Size | 741 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001012727.1 |
RefSeq Size | 1480 bp |
RefSeq ORF | 741 bp |
Locus ID | 10555 |
UniProt ID | O15120 |
Protein Families | Transmembrane |
Protein Pathways | Ether lipid metabolism, Glycerolipid metabolism, Glycerophospholipid metabolism, Metabolic pathways |
MW | 27.3 kDa |
Gene Summary | This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. The protein is located within the endoplasmic reticulum membrane and converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. Mutations in this gene have been associated with congenital generalized lipodystrophy (CGL), or Berardinelli-Seip syndrome, a disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200622 | AGPAT2 (Myc-DDK-tagged)-Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 2 |
CNY 2,400.00 |
|
RC200622L3 | Lenti ORF clone of Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200622L4 | Lenti ORF clone of Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG200622 | AGPAT2 (tGFP-tagged) - Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 2 |
CNY 4,370.00 |