SEC61G (NM_001012456) Human Untagged Clone

CAT#: SC301663

SEC61G (untagged)-Human Sec61 gamma subunit (SEC61G), transcript variant 2



  "NM_001012456" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to Sec61 gamma subunit (Sec61 gamma subunit)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SSS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301663 representing NM_001012456.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATCAGGTAATGCAGTTTGTTGAGCCAAGTCGGCAGTTTGTAAAGGACTCCATTCGGCTGGTTAAA
AGATGCACTAAACCTGATAGAAAAGAATTCCAGAAGATTGCCATGGCAACAGCAATAGGATTTGCTATA
ATGGGATTCATTGGCTTCTTTGTGAAATTGATCCATATTCCTATTAATAACATCATTGTTGGTGGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001012456
Insert Size 207 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001012456.1
RefSeq Size 480 bp
RefSeq ORF 207 bp
Locus ID 23480
UniProt ID P60059
Protein Families Transmembrane
Protein Pathways Vibrio cholerae infection
MW 7.7 kDa
Gene Summary The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. Oligomers of the Sec61 complex form a transmembrane channel where proteins are translocated across and integrated into the ER membrane. This complex consists of three membrane proteins- alpha, beta, and gamma. This gene encodes the gamma-subunit protein. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...