United States
Germany
Japan
United Kingdom
China
Midkine (MDK) (NM_001012334) Human Untagged Clone
CAT＃: SC301634
MDK (untagged)-Human midkine (neurite growth-promoting factor 2) (MDK), transcript variant 1
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ARAP; MK; NEGF2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001012334 edited
GCAGCGCGGGCAGCGAGCGAGATGCAGCACCGAGGCTTCCTCCTCCTCACCCTCCTCGCC CTGCTGGCGCTCACCTCCGCGGTCGCCAAAAAGAAAGATAAGGTGAAGAAGGGCGGCCCG GGGAGCGAGTGCGCTGAGTGGGCCTGGGGGCCCTGCACCCCCAGCAGCAAGGATTGCGGC GTGGGTTTCCGCGAGGGCACCTGCGGGGCCCAGACCCAGCGCATCCGGTGCAGGGTGCCC TGCAACTGGAAGAAGGAGTTTGGAGCCGACTGCAAGTACAAGTTTGAGAACTGGGGTGCG TGTGATGGGGGCACAGGCACCAAAGTCCGCCAAGGCACCCTGAAGAAGGCGCGCTACAAT GCTCAGTGCCAGGAGACCATCCGCGTCACCAAGCCCTGCACCCCCAAGACCAAAGCAAAG GCCAAAGCCAAGAAAGGGAAGGGAAAGGACTAGACGCCAAGCCTGGATGCCAAGGAGCCC CTGGTGTCACATGGGGCCTGGCCCACGCCCTCCCTCTCCCAGGCCCGAGATGTGACCCAC CAGTGCCTTCTGTCTGCTCGTTAGCTTTAATCAATCATGCCCTGCCTTGTCCCTCTCACT CCCCAGCCCCACCCCTAAGTGCCCAAAGTGGGGAGGGACAAGGGATTCTGGGAAGCTTGA GCCTCCCCCAAAGCAATGTGAGTCCCAGAGCCCGCTTTGTTCTTCCCCACAATTCCATTA CTAAGAAACACAGCAAAAAACTGATCTTTTCC |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001012334 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6-XL5 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001012334.1, NP_001012334.1 |
| RefSeq Size | 997 bp |
| RefSeq ORF | 432 bp |
| Locus ID | 4192 |
| UniProt ID | P21741 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Gene Summary | This gene encodes a member of a small family of secreted growth factors that binds heparin and responds to retinoic acid. The encoded protein promotes cell growth, migration, and angiogenesis, in particular during tumorigenesis. This gene has been targeted as a therapeutic for a variety of different disorders. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1, 2, 3, 4, and 5 encode the same isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221818 | MDK (Myc-DDK-tagged)-Human midkine (neurite growth-promoting factor 2) (MDK), transcript variant 1 |
CNY 1,200.00 |
|
| RC221818L3 | Lenti ORF clone of Human midkine (neurite growth-promoting factor 2) (MDK), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC221818L4 | Lenti ORF clone of Human midkine (neurite growth-promoting factor 2) (MDK), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG221818 | MDK (tGFP-tagged) - Human midkine (neurite growth-promoting factor 2) (MDK), transcript variant 1 |
CNY 2,800.00 |
其它Midkine产品
