Destrin (DSTN) (NM_001011546) Human Untagged Clone

CAT#: SC301574

DSTN (untagged)-Human destrin (actin depolymerizing factor) (DSTN), transcript variant 2



  "NM_001011546" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
DSTN (Destrin) mouse monoclonal antibody, clone OTI2F7 (formerly 2F7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACTDP; ADF; bA462D18.2; HEL32
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001011546, the custom clone sequence may differ by one or more nucleotides


ATGAAAGTTCGTAAATGCTCCACACCAGAAGAAATCAAGAAAAGAAAGAAGGCTGTCATTTTTTGTCTCA
GTGCAGACAAAAAGTGCATCATTGTAGAAGAAGGCAAAGAGATCTTGGTTGGAGATGTTGGTGTAACCAT
AACTGATCCTTTCAAGCATTTTGTGGGAATGCTTCCTGAAAAAGATTGTCGCTATGCTTTGTATGATGCA
AGCTTTGAAACAAAAGAATCCAGAAAAGAAGAGTTGATGTTTTTTTTGTGGGCACCAGAACTAGCACCTC
TGAAAAGTAAAATGATCTATGCAAGCTCCAAGGATGCAATTAAAAAGAAATTTCAAGGCATAAAACATGA
ATGTCAAGCAAATGGACCAGAAGATCTCAATCGGGCTTGTATTGCTGAAAAGTTAGGTGGATCCTTAATT
GTAGCCTTTGAAGGATGCCCTGTGTAG


Restriction Sites Please inquire     
ACCN NM_001011546
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001011546.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001011546.1, NP_001011546.1
RefSeq Size 1746 bp
RefSeq ORF 447 bp
Locus ID 11034
UniProt ID P60981
Gene Summary The product of this gene belongs to the actin-binding proteins ADF family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and binds to actin monomers (G-actin). Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) contains an additional segment in the coding region compared to variant 1. This difference causes translation initiation at a downstream ATG and an isoform (b) with a shorter N-terminus compared to an isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...