United States
Germany
Japan
United Kingdom
China
Destrin (DSTN) (NM_001011546) Human Untagged Clone
CAT＃: SC301574
DSTN (untagged)-Human destrin (actin depolymerizing factor) (DSTN), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACTDP; ADF; bA462D18.2; HEL32 |
| Vector | PCMV6-Neo |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001011546, the custom clone sequence may differ by one or more nucleotides
ATGAAAGTTCGTAAATGCTCCACACCAGAAGAAATCAAGAAAAGAAAGAAGGCTGTCATTTTTTGTCTCA GTGCAGACAAAAAGTGCATCATTGTAGAAGAAGGCAAAGAGATCTTGGTTGGAGATGTTGGTGTAACCAT AACTGATCCTTTCAAGCATTTTGTGGGAATGCTTCCTGAAAAAGATTGTCGCTATGCTTTGTATGATGCA AGCTTTGAAACAAAAGAATCCAGAAAAGAAGAGTTGATGTTTTTTTTGTGGGCACCAGAACTAGCACCTC TGAAAAGTAAAATGATCTATGCAAGCTCCAAGGATGCAATTAAAAAGAAATTTCAAGGCATAAAACATGA ATGTCAAGCAAATGGACCAGAAGATCTCAATCGGGCTTGTATTGCTGAAAAGTTAGGTGGATCCTTAATT GTAGCCTTTGAAGGATGCCCTGTGTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001011546 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001011546.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001011546.1, NP_001011546.1 |
| RefSeq Size | 1746 bp |
| RefSeq ORF | 447 bp |
| Locus ID | 11034 |
| UniProt ID | P60981 |
| Gene Summary | The product of this gene belongs to the actin-binding proteins ADF family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and binds to actin monomers (G-actin). Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) contains an additional segment in the coding region compared to variant 1. This difference causes translation initiation at a downstream ATG and an isoform (b) with a shorter N-terminus compared to an isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213851 | DSTN (Myc-DDK-tagged)-Human destrin (actin depolymerizing factor) (DSTN), transcript variant 2 |
CNY 1,200.00 |
|
| RC213851L3 | Lenti-ORF clone of DSTN (Myc-DDK-tagged)-Human destrin (actin depolymerizing factor) (DSTN), transcript variant 2 |
CNY 5,890.00 |
|
| RC213851L4 | Lenti-ORF clone of DSTN (mGFP-tagged)-Human destrin (actin depolymerizing factor) (DSTN), transcript variant 2 |
CNY 5,890.00 |
|
| RG213851 | DSTN (tGFP-tagged) - Human destrin (actin depolymerizing factor) (DSTN), transcript variant 2 |
CNY 2,800.00 |
其它Destrin产品
