C1QL3 (NM_001010908) Human Untagged Clone
CAT#: SC301522
C1QL3 (untagged)-Human complement component 1, q subcomponent-like 3 (C1QL3)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C1ql; C1QTNF13; CTRP13; K100 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001010908 edited
ATGGTGCTGCTGCTGGTGATCCTCATCCCGGTGCTGGTGAGCTCGGCCGGCACGTCGGCG CACTACGAGATGCTGGGCACCTGCCGCATGGTCTGCGACCCCTACGGGGGCACCAAGGCG CCCAGCACCGCTGCCACGCCCGACCGCGGCCTCATGCAGTCCCTGCCCACCTTCATCCAG GGCCCCAAAGGCGAGGCCGGCAGGCCCGGGAAGGCGGGTCCGCGCGGGCCCCCCGGAGAG CCCGGGCCACCCGGCCCCATGGGGCCCCCGGGCGAGAAGGGCGAGCCGGGCCGCCAAGGC CTGCCGGGCCCGCCCGGGGCGCCCGGCCTGAACGCGGCCGGGGCCATCAGCGCCGCCACC TACAGCACGGTGCCCAAGATCGCCTTCTACGCCGGCCTCAAGCGGCAGCATGAAGGCTAC GAGGTGCTCAAGTTCGACGACGTGGTCACCAACCTCGGAAACCACTACGACCCCACCACC GGCAAGTTCACCTGCTCCATCCCGGGCATCTACTTCTTCACCTACCACGTCCTGATGCGC GGAGGGGACGGCACCAGCATGTGGGCTGATCTCTGCAAAAACAACCAGGTGCGTGCTAGT GCAATTGCCCAAGATGCTGATCAGAATTACGACTATGCCAGTAACAGTGTGGTTCTTCAT TTGGAGCCGGGAGATGAAGTCTATATCAAATTAGATGGCGGGAAAGCCCATGGAGGAAAC AACAACAAATACAGCACGTTTTCTGGATTTATTATTTATGCTGACTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_001010908 |
Insert Size | 4700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001010908.1, NP_001010908.1 |
RefSeq Size | 2493 bp |
RefSeq ORF | 768 bp |
Locus ID | 389941 |
UniProt ID | Q5VWW1 |
Protein Families | Secreted Protein |
Gene Summary | May regulate the number of excitatory synapses that are formed on hippocampus neurons. Has no effect on inhibitory synapses (By similarity). Plays a role in glucose homeostasis. Via AMPK signaling pathway, stimulates glucose uptake in adipocytes, myotubes and hepatocytes and enhances insulin-stimulated glucose uptake. In a hepatoma cell line, reduces the expression of gluconeogenic enzymes G6PC and PCK1 and hence decreases de novo glucose production (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223500 | C1QL3 (Myc-DDK-tagged)-Human complement component 1, q subcomponent-like 3 (C1QL3) |
CNY 3,600.00 |
|
RC223500L3 | Lenti-ORF clone of C1QL3 (Myc-DDK-tagged)-Human complement component 1, q subcomponent-like 3 (C1QL3) |
CNY 5,890.00 |
|
RC223500L4 | Lenti-ORF clone of C1QL3 (mGFP-tagged)-Human complement component 1, q subcomponent-like 3 (C1QL3) |
CNY 5,890.00 |
|
RG223500 | C1QL3 (tGFP-tagged) - Human complement component 1, q subcomponent-like 3 (C1QL3) |
CNY 5,200.00 |