C1orf69 (IBA57) (NM_001010867) Human Untagged Clone

CAT#: SC301491

IBA57 (untagged)-Human IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae) (IBA57)



  "NM_001010867" in other vectors (6)

CNY 5,800.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


IBA57 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1orf69; MMDS3; SPG74
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301491 representing NM_001010867.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGACCGCGGCGCTGCTTCGAGGCGCCACTCCGGGGCGCGGCGGCCCGGTCTGGCGCTGGCGGCTG
CGCGCGGCCCCAAGGTGCCGCCTGGCCCACAGCTCCTGCAGTCCTGGTGGCGACCCAACGGCCGGAGCG
GCCTGGGCCTGCTTCCGGCTGGACGGGCGCACCCTGCTGCGCGTGCGTGGCCCCGACGCGGCGCCCTTC
CTGCTAGGGCTGCTGACCAATGAACTGCCGCTTCCGAGTCCTGCGGCCGCGGGGGCCCCGCCTGCTGCG
CGCGCGGGCTACGCCCACTTCCTGAACGTGCAGGGCCGGACGCTCTATGACGTCATCTTGTACGGGCTC
CAGGAACACTCGGAGGTGTCTGGCTTCCTTCTGGAGTGTGACAGCTCGGTGCAGGGCGCGCTGCAGAAG
CACCTCGCGCTATACAGGATCCGGCGGAAGGTCACGGTGGAGCCGCACCCGGAGCTGCGAGTGTGGGCG
GTGTTGCCCAGTTCCCCTGAGGCCTGCGGGGCTGCATCGCTGCAGGAGAGGGCAGGGGCTGCCGCCATC
CTCATCCGCGACCCGCGAACAGCACGCATGGGGTGGCGGCTCCTCACCCAGGATGAAGGCCCAGCCCTG
GTGCCCGGGGGCCGGCTCGGGGACTTGTGGGATTATCACCAGCACCGATACCTGCAAGGCGTTCCTGAG
GGGGTCCGAGACTTGCCTCCTGGGGTGGCCCTGCCCCTGGAGTCCAACCTGGCCTTCATGAACGGCGTG
AGCTTCACCAAAGGCTGCTACATTGGCCAGGAGCTGACGGCCCGCACCCACCACATGGGCGTCATCCGC
AAGCGCCTCTTCCCTGTCCGGTTCTTGGACCCCCTTCCCACCAGTGGCATCACCCCTGGTGCCACGGTG
CTGACTGCCTCAGGACAGACTGTGGGCAAGTTCAGGGCTGGCCAGGGCAACGTGGGGCTGGCCCTGCTG
TGGTCAGAGAAGATCAAGGGTCCTCTGCACATCAGAGCCTCTGAGGGTGCCCAGGTGGCCTTAGCCGCA
TCTGTGCCAGACTGGTGGCCTACAGTCTCCAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001010867
Insert Size 1071 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001010867.3
RefSeq Size 7824 bp
RefSeq ORF 1071 bp
Locus ID 200205
UniProt ID Q5T440
MW 38.2 kDa
Gene Summary The protein encoded by this gene localizes to the mitochondrion and is part of the iron-sulfur cluster assembly pathway. The encoded protein functions late in the biosynthesis of mitochondrial 4Fe-4S proteins. Defects in this gene have been associated with autosomal recessive spastic paraplegia-74 and with multiple mitochondrial dysfunctions syndrome-3. Two transcript variants encoding different isoforms have been found for this gene. The smaller isoform is not likely to be localized to the mitochondrion since it lacks the amino-terminal transit peptide. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...